Skip to main content

Table 2 Primers for qRT-PCR of candidate differentially expressed genes

From: Transcriptome analysis reveals gene responses to herbicide, tribenuron methyl, in Brassica napus L. during seed germination

genes Primer sequence(5′ - 3′)
  Forward primer Reverse primer
BraACTIN 7 GGAGCTGAGAGATTCCGTTG GAACCACCACTGAGGACGAT
BnaA06g30520D ACCGTCTTCTCTGAGGTATGTA ATGCCAAGACCTACTAGGAGTA
BnaA04g22040D GTGCAGACAACAAGTGACATAG TCACCGCTCTCATATCATTTGA
BnaC07g26270D TTGTATCTGGGACACGTGTTAA TTTTAGTTCCTTAGTCGGTGCT
BnaC06g37860D GAATCGAGATTCTCCATCAACG GCAACATTCAAAGTAGCTCCAA
BnaA05g27660D ATGTGCCTTCAAGACTCCGATA CTCCTCCTTTTCCTCAAGTCAA
BnaA01g20660D CATCGTACGAGAAACCATTGTC ATATCTGCGCATGAAACAGTTC
BnaA03g52510D CTCCAGCGACTAGGAATATTGT AATTTTTACGGACGTCACCTTG
BnaC09g50000D TACAACGAGACAAACATCAACG AAAAATTAGCGGAGTTGACGTC
BnaA09g00120D GATGTTCATCGTCACTTACACG TATCCGACAAAGACAGCAGATC
BnaA09g19500D CGATTCTCCCCGACCTCAAC CCGTTAGAATCAGCCTCCGT
BnaA09g08020D CGATTGATAGCAACACTGATGG CTCTGAGTCATGTTCTTCCAGT
BnaC01g25380D CGACAAGAACAAGACTTTCGTC GATAAGCAAAGACGGTTTCGAC
  1. Note: BnaC01g25380D encodes ALS isozyme