Skip to main content

Table 1 Primers used for qRT-PCR

From: Transcriptome analysis of ovary tissues from low- and high-yielding Changshun green-shell laying hens

Gene Symbol Gene Name Primer Sequence (5’-3’) Accession Number
OVA ovalbumin F: CACAAGCAATGCCTTTCAGA NM_205152.2
R: GACTTCATCAGGCAACAGCA
OVALX ovalbumin-related protein X F: AAGATCCTGGAGCTCCCATT NM_001276386.1
R: CTCCATGGTATTGGGATTGG
OVALY ovalbumin-related protein Y F: GCAAACCTGTGCAAATGATG NM_001031001.1
R: GTCTTCTCAATCCGCTCCAG
AMN amnion associated transmembrane protein F: GCTCTGGGTTCACAGCTTTC NM_001277516.1
R: TGGAAGATGACGTGGTCGTA
POMC proopiomelanocortin F: AAGGCGAGGAGGAAAAGAAG XM_015285103.2
R: CTTTTGACGATGGCGTTTTT
CGA glycoprotein hormones F: AGGGTTGTCCAGAGTGCAAG NM_001278021.1
R: TCTTGGTGAAAGCCTTTGCT
β-actin beta-actin F: GAGAAATTGTGCGTGACATGA NM_205518.1
R: CCTGAACCTCTCATTGCCA