Skip to main content

Table 5 Primers used for quantitative real-time RT-PCR. Primers were designed using NCBI’s Primer BLAST. Ten DEGs were selected to validate RNA-sequencing results by qRT-PCR. ACTB, GAPDH and 18S rRNA were used as reference genes. The designed primers are listed with product length and annealing temperature. F forward primer, R reverse primer

From: A comparative analysis of the intrauterine transcriptome in fertile and subfertile mares using cytobrush sampling

Gene Primer sequence 5′-3’ Product length (bp) Annealing Temp C° Accession no./reference of target transcript
SLC10A2 F: ATCGTTCACCTACGAGGAGC 191 66 XM_001493450.3
R: TCACCTTGTGGAGCGATGAC    
SLC16A9 F: TGTTCTTTGCTGGGCTTGGA 110 68 XM_023643589.1
R: CAGGACGCAGAAGCCACTAA    
ITGB3 F: GCACCCGTTACTGTCGTGAT 145 65 NM_001081802.1
R: AGGATGGACTTTCCACTGGC    
THBS2 F: TGGCTGGAAAGACTACACCG 107 65 NM_001163117.2
R: CTGAATCCGCCATGACCTGT    
FN1 F: GGTCGTTACTGTGGGCAACT 101 65 XM_023642280.1
R: CCTCTCCGATGGCGTAATGG    
COL6A1 F: CCTCCTGGGATAAACGGCAC 184 65 XM_001488351.5
R: ACTCGTCCATCTCTGGTCGT    
ACKR3 F: ATGCCTGAGTAGCCTGGAGA 113 65 XM_023642191.1
R: GTCCTGTGGTGATGCAAACG    
LOC100073089 (ENPP3) F: TAGAATACGTGGTCAACACCAG 190 68 XM_023651094.1
R: TCAACCCAGTTGGCTTCCTG    
PDE10A F: GCGTGAATTGTAGCAGCCAG 76 65 XM_023633145.1
R: ACTGATTGCAGAAAGACACTTCC    
MMP25 F: ATGTCACCGTCAGCAACACAG 189 70 XM_023633145.1
R: GTCCAGGCTTGAGAGTGGCT    
ACTB F: TCCCAGCACGATGAAGATCAA 189 68 XM_023655002.1
R: GGTGGATCGCACTAACAGT    
GAPDH F: ATTGCCCTCAACGACCACTT 140 70 NM_001163856.1
R: TCTTGCTGGGTGATTGGTGG    
18S rRNA F: GCGTGTGCCTACCCTACGCC 165 68 AJ311673.1/ [24]
R: ATCGTTCACCTACGAGGAGC