Skip to main content

Table 8 Selected primer and sequence

From: Selection of functional EPHB2 genotypes from ENU mutated grass carp treated with GCRV

Gene Primer name Forward primer (5′-3′) Reverse primer (5′-3′) Temperature
CI01000184_00984445_00984988.mRNA APPL2 CCGTGGATGACACCGCCTAC CACACTCCACGGCCATGACA 59.7
CI01000087_01389941_01395452.mRNA BNIP3L TCTGAGTGTGTCCATCGAGT GAGATCCAGCAGAACACTGG 58.0
CI01000190_01446777_01465687.mRNA NLRP12 TCTGAGTGTGTCCATCGAGT GAGATCCAGCAGAACACTGG 58.0
CI01000190_01061817_01090001.mRNA EPHB2 CAGAGGCATTCATCTTCCCA GAGAGAGGGCAGGGGAAAA 58.1
CI01000240_00049921_00050822. mRNA SAMD9L GCAGCAGAATGATGTGGTGAC TGTGTTGGTGAATGCTTTGAAT 58.5