Skip to main content

Table. 2 Sixteen DEGs selected for validation with RT-qPCR

From: Deploying new generation sequencing for the study of flesh color depletion in Atlantic Salmon (Salmo salar)

Gene ID DEG Group Forward primer 5’-3’ Reverse primer 5’-3’
(mfi2) antigen p97 (melanoma associated) QuantSeq only cagcagggaaaagctacgg tcactgtcccctgtgtagctc
(epdm) ependymin-like QuantSeq only aaccacacaatgcaagccta agctcccaacagccagatac
(lyama) lysosomal alpha-mannosidase QuantSeq only aacagctacctgcagacgtg tttccttgagatgggaccac
(fabp1) fatty acid binding protein 1, liver QuantSeq only gggcaccaaggtcatagtca tcttctctccagtcaaagtctcg
(fertn-m) ferritin, middle subunit-like QuantSeq only cgtgatgagtggggcaat cagggcctggttcacatt
(s2p4a-l) SH2 domain-containing protein 4 A-like TruSeq only gcaacagcacagacgaccta atgttgctgtggtgggttct
(noxo1) NADPH oxidase organizer 1-like TruSeq only atgggctggaggacatga gctcacaaaagggtgtgtca
(fclt3) fucolectin-3-like TruSeq only atgagggcattcacaacaca tccttccacacctgatgtcc
(tetn) tetranectin TruSeq only gtcagtggtgtgcgtttgtt tctgttggaatgtggattgc
(ovcm2) ovochymase-2-like TruSeq only cgtttcctcagcaaccaag gggatcggtggtccagtaa
(ldltn) ladderlectin-like Both libraries ctttgtgtcgccctctctg gacattgttgagtatttggctgtc
(cd209) CD209 antigen-like Both libraries tggtcacaattaaataatgttttgg gaatgtttatttagtcatgctggtg
(es1p) ES1 protein homolog, mitochondrial-like Both libraries agttgacttccagttacactacaacag gcagtctgggtcgtcttctc
(umy1b) unconventional myosin-Ib-like Both libraries aggaatgccatgcagattgt accagctccagaaccgact
(glfsy) GDP-L-fucose synthase Both libraries ctgattggctgtcaagcaac gaaggtttgactccccatga
(18 S) 18 S ribosomal RNA House keeping gene aggactccggttctattttgtg cggccgtccctcttaatc