Skip to main content

Table 2 Changes of transcription factor binding sites (TFBSs) caused by the SNPs in the 5′ UTR and flanking region of HTR1B

From: Determination of genetic effects and functional SNPs of bovine HTR1B gene on milk fatty acid traits

SNP Sequence TF Full name
g.17307103A > T CCCCAACGCGATTCCCTCCTT   
CCCCAACGCGTTTCCCTCCTT HMX2 Hmx2/Nkx5–2 homeodomain transcription factor
PAX2 Zebrafish PAX2 paired domain protein
g.17305206 T > G TTTTGAAGTTTTTTTTTTTTTT   
TTTTGAAGTTTGTTTTTTTTTT FOXP1ES Alternative splicing variant of FOXP1, activated in ESCs
g.17303761C > T ACCTCGCCCTCGACCTCTCGC MIZ1 Myc-interacting Zn finger protein 1, zinc finger and BTB domain containing 17 (ZBTB17)
CUX2 Cut-like homeobox 2, dimeric binding site
ACCTCGCCCTTGACCTCTCGC DREAM Downstream regulatory element-antagonist modulator, Ca2 + −binding protein of the neuronal calcium sensors family that binds DRE (downstream regulatory element) sites as a tetramer
PPAR-RXR PPAR/RXR heterodimers, DR1 sites
  1. Notes: TF transcrition factor