Table 2 Changes of transcription factor binding sites (TFBSs) caused by the SNPs in the 5′ UTR and flanking region of HTR1B
From: Determination of genetic effects and functional SNPs of bovine HTR1B gene on milk fatty acid traits
SNP | Sequence | TF | Full name |
|---|---|---|---|
g.17307103A > T | CCCCAACGCGATTCCCTCCTT |  |  |
CCCCAACGCGTTTCCCTCCTT | HMX2 | Hmx2/Nkx5–2 homeodomain transcription factor | |
PAX2 | Zebrafish PAX2 paired domain protein | ||
g.17305206 T > G | TTTTGAAGTTTTTTTTTTTTTT |  |  |
TTTTGAAGTTTGTTTTTTTTTT | FOXP1ES | Alternative splicing variant of FOXP1, activated in ESCs | |
g.17303761C > T | ACCTCGCCCTCGACCTCTCGC | MIZ1 | Myc-interacting Zn finger protein 1, zinc finger and BTB domain containing 17 (ZBTB17) |
CUX2 | Cut-like homeobox 2, dimeric binding site | ||
ACCTCGCCCTTGACCTCTCGC | DREAM | Downstream regulatory element-antagonist modulator, Ca2 + −binding protein of the neuronal calcium sensors family that binds DRE (downstream regulatory element) sites as a tetramer | |
PPAR-RXR | PPAR/RXR heterodimers, DR1 sites |