Skip to main content

Table 1 The differentially expressed miRNAs

From: Altered expression of microRNAs in the rat diaphragm in a model of ventilator-induced diaphragm dysfunction after controlled mechanical ventilation

miRNA ID Log2FC p-value up/down Sequence Length
novel10_mature 2.585894365 0.000420713 Up TCAGTGTGCTAGAGTCCTCGAAGA 24
novel10_star 3.578370892 4.88E-05 Up TCCGAGGCTAGAGTCACGCTC 21
novel179_mature 2.886092162 0.048552039 Up ATCTCGGTGGGACCGCCA 18
novel214_mature 1.572344804 0.008723536 Up ACTGGACTTGGAGTCAGAAGA 21
novel231_mature -3.001989158 0.04517486 Down TTGGTACCTGTTTCCTGTTT 20
novel237_mature 2.953174649 0.031303233 Up CGTGACTGTACCTGGTATT 19
novel30_mature 1.558144602 0.032272673 Up ATATAGAGGATAATATAAATGT 22
novel316_mature 1.470591476 0.013690233 Up AAAGTTTAACTTCTGCCA 18
novel31_mature -1.566475963 0.027139728 Down TATGGCGCTCCTCTGAGTAGA 21
novel322_mature 3.342200406 0.041283283 Up TGACCCTCCTTTGCTCCTCAGG 22
novel379_mature -3.384012887 0.037334425 Down TCTCCGGCCTCTCGCGGGACCT 22
novel402_mature 1.13285745 0.043958532 Up TCTGCTGACTGCCCATGGA 19
novel427_mature 2.252020331 0.000142047 Up TCCGGCTGCGTCGGGCGTG 19
novel428_mature 3.867171168 0.020676937 Up CCTGGGGCGGGCTGTGGGCTGTC 23
novel458_mature -1.922705588 0.000263353 Down CACTGGACTTGGAGTCAGAAGA 22
novel462_mature 4.274081175 0.003197987 Up TTTGGTCTAAGGCTGGAACTTT 22
novel566_mature 1.045979075 0.022908305 Up CATGGACGGTGTGAGGCCA 19
novel73_mature -3.424160743 0.04782349 Down TAAACCAGTCAGAGGATGGTAGG 23
novel75_mature 1.622119991 0.026499961 Up ATGTAGTACTAAGTCTGTCACG 22
rno-miR-122-5p 1.47954028 0.04375855 Up TGGAGTGTGACAATGGTGTTTG 22
rno-miR-1298 -3.537711659 0.018835052 Down TTCATTCGGCTGTCCAGATGTA 22
rno-miR-130b-5p 1.596831274 0.010734419 Up ACTCTTTCCCTGTTGCACTACT 22
rno-miR-147 1.347240696 0.025313554 Up GTGTGCGGAAATGCTTCTGCTA 22
rno-miR-183-5p 1.047179965 0.016657263 Up TATGGCACTGGTAGAATTCACT 22
rno-miR-200a-5p -1.862942448 0.049359836 Down CATCTTACCGGACAGTGCTGG 21
rno-miR-200c-3p -1.572397551 0.014783046 Down TAATACTGCCGGGTAATGATG 21
rno-miR-208b-3p 1.183001365 0.009169665 Up ATAAGACGAACAAAAGGT 18
rno-miR-296-3p -1.170361668 0.024842243 Down GAGGGTTGGGTGGAGGCTCTCC 22
rno-miR-3571 -1.516247884 0.00029504 Down TACACACTTCTTTACATTCCATA 23
rno-miR-375-3p -2.086674249 0.002167474 Down TTTGTTCGTTCGGCTCGCGTGA 22
rno-miR-377-5p -1.005516248 0.021749086 Down AGAGGTTGCCCTTGGTGAATTC 22
rno-miR-501-5p -1.925263887 0.045437012 Down AATCCTTTGTCCCTGGGTGA 20
rno-miR-741-3p -1.685014571 0.005957175 Down AAAGATGCCACGCTATGTAGAT 22
rno-miR-743b-3p -2.333443622 0.040744086 Down GAAAGACACCATACTGAATAGA 22
rno-miR-874-3p -3.638678583 0.002704144 Down CTGCCCTGGCCCGAGGGACCGA 22
rno-miR-877 3.735698614 0.048157151 Up GTAGAGGAGATGGCGCAGGG 20
rno-miR-92a-1-5p 1.784733476 0.012196833 Up AGGTTGGGATTTGTCGCAATGCT 23
rno-miR-96-5p 1.398245576 0.002265536 Up TTTGGCACTAGCACATTTTTGCT 23
  1. FC fold change