Skip to main content

Table 3 Primers employed in the qPCR assay. Reference transcripts in the P. acuta transcriptome assembly are listed. *Primers for the ß tubulin are adopted from a previous study

From: Genetic changes involving the coral gastrovascular system support the transition between colonies and bailed-out polyps: evidence from a Pocillopora acuta transcriptome

Functional annotation Primer sequence (5’ – 3’) Reference transcript
Angiotensin-converting enzyme f: gataaacagcagcgggaag
r: agattcggtgacaaagacaag
TRINITY_DN5954_c0_g3_i1
  f: actttctctgaaccccgac
r: atccctccaccattccttcc
TRINITY_DN10767_c0_g1_i10
  f: caagtggatgatggaacagag
r: agtgttgaacagtgtgggaag
TRINITY_DN3110_c4_g2_i4
Endothelin-converting enzyme f: cggaacatcaagcacagag
r: aaaggacggtaatcaacacag
TRINITY_DN4184_c0_g1_i8
  f: ctactcacccaggcaaaatc
r: ccaatcaccataccaattccac
TRINITY_DN14970_c0_g1_i2
  f: tgactccccccactgtaaac
r: ccaacaaccattccgattcc
TRINITY_DN36866_c0_g1_i3
Actin f: tgtctcgatcaataaaccttcc
r: cccataccaaccatcactcc
TRINITY_DN21309_c1_g1_i1
ß tubulin f: gcagttcacggctatgttc*
r: ttttcaccctcctcttcctc*
Chuang and Mitarai (2020)