Skip to main content

Table 2 Primers used for qRT-PCR

From: Identification and response analysis of xyloglucan endotransglycosylase/hydrolases (XTH) family to fluoride and aluminum treatment in Camellia sinensis

Primer Forward primer sequence Reverse primer sequence
β-actin CTCAGTCCAAAAGAGGTATTCT GTAGAATGTGTGATGCCAGATC
CsXTH1 AAGTGGTTTCAAGTCCCTG CTCTATGTCAATCTCATCGTG
CsXTH2 GATTGGGCAACAAGAGGTG GCTTTGAGTCCGTGCAGTAA
CsXTH3 GACCACCTTCACCTGGCTAC TGGATGTGCTTCGTTGTTTG
CsXTH4 ACCCTACTACCGATTTCCA CAGTCTTCACAAGTCCACCT
CsXTH5 TGTCAAGGCAAGGGTAATAGA GTAGCCCAATCATCAGCGT
CsXTH6 ATGATACAGGTTGTGGGTTT ATCTCACGGTTTCCAGTTC
CsXTH7 GGAACAGAACAGGGCAACC GGAAACCTCACTCCCAAATC
CsXTH8 TTGTTATGACACGGTAAGGTA ATGCTGGTCTCCATAGTTCTT
CsXTH9 GGTCCTCAGCATCAAAGA AATCCTCCCATCCCCAC
CsXTH10 TGCTTCTATCAAACTTCCTGC CCCTCCCATTGCTTCTGT
CsXTH11 CCACCAAGGACTTCCACTC AATCGTCTGCGTTCCAAAT
CsXTH12 TATGTTGATGATGTCCCAATAAGAG AGACGAAGGGCTGGAAGCGGTAGTT
CsXTH13 ACGCTGATGACTGGGCTAC TTTGAACAGGAAGAGGAGGAA
CsXTH14 GGTCAAAGGGTCCATTCATAG TCTCATTCTGCCACCAGTTAGT