Skip to main content

Table 2 Primers used for qRT-PCR

From: Circadian miR-449c-5p regulates uterine Ca2+ transport during eggshell calcification in chickens

Gene Sequence (5′ - 3′) Product Length (bp) Annealing Temperature (°C)
ATP2B4 F: CCTCCGTCAATTCCACTCCC 89 58
R: CTACGGAACGCATTCACCAC
GAPDH F: TCCTCCACCTTTGATGCG 146 59
R: GTGCCTGGCTCACTCCTT
  1. F Forward primer, R Reverse primer