From: A versatile 5′ RACE-Seq methodology for the accurate identification of the 5′ termini of mRNAs
Name | Sequence (5′ → 3′) | Description |
---|---|---|
dTSO | AAGCAGTGGTATCAACGCAGAGTACGCGGG | TSO with typical DNA oligonucleotides |
drTSO | AAGCAGTGGTATCAACGCAGAGTACGCr(GGG) | Chimeric DNA/RNA oligo sequence that carries 3 riboguanosines r(GGG) at its 3′ end |
C3-TSO | AAGCAGTGGTATCAACGCAGAGTACGCr(GGG)-C3 | Chimeric DNA/RNA oligo sequence that carries 3 riboguanosines r(GGG) at its 3′ end and a 3′ C3-spacer modification |
F | AAGCAGTGGTATCAACGCAGAG | Forward universal primer designed to anneal at the TSO sequence for RACE reaction |
Fnested | CAGTGGTATCAACGCAGAGTAC | Forward universal primer designed to anneal at the TSO sequence for nested RACE reaction |