Skip to main content

Table 2 Primer’s information used for qPCR of DoG family in P. edulis (Moso bamboo)

From: Genome-wide identification and expression characterization of the DoG gene family of moso bamboo (Phyllostachys edulis)

Accession number Gene number Sequence (5'-3') Annealing temperature of PCR (℃) Amplicon length (bp)
PH02Gene44830.t1 PeDOG6-F GGAGAAGACAGACAAGAA 76.5 90
PeDOG6-R CGAATGAAACCACTCAAC
PH02Gene37785.t1 PeDOG9-F AGCTGTCCAACCTTGAAG 76 91
PeDOG9-R CCTAAGACTGTCAATCCGT
PH02Gene37919.t1 PeDOG12-F CAGACATTGATGAGAGGAA 76.7 117
PeDOG12-R AGTATTCTATGAAGCAGCAG
PH02Gene39868.t1 PeDOG14-F GGGAATGGAAACGACAAC 89.5 151
PeDOG14-R CAAGAAGCTCACGACCTA
PH02Gene16035.t1 PeDOG18-F GCACGATGGTTGGAAGAA 75.1 95
PeDOG18-R TAGAGGCAACACAACAACT
PH02Gene31633.t1 PeDOG19-F TAGGCAACAGGGTGTGTA 80.1 93
PeDOG19-R ACAAACTCTACCTCATGCG
PH02Gene24017.t3 PeDOG21-F AACAAGGTCCTGAGAAGA 77.9 90
PeDOG21-R TAGGTCGTTGATCTCTGT
PH02Gene47106.t1 PeDOG23-F CACTACGAGAGGTTGTTC 82.2 108
PeDOG23-R GTGTAGAAGGAGACCTAG
PH02Gene36596.t1 PeDOG24-F AGAAGGTCCTCAGAAGATT 77.4 90
PeDOG24-R TAGGTCGTTGATCTCTGTT
Nucleotide tract-binding protein NTB-F TCTTGTTTGACACCGAAGAGGAG 60 133
NTB-R AATAGCTGTCCCTGGAGGAGTTT