Skip to main content

Table 1 Primer sequences

From: Comparative analysis of novel and common reference genes in adult tissues of the mussel Mytilus galloprovincialis

Gene   Primer sequence 5′-3′ Amplicon Intron Refs E
Ef1α-g F TTTCTGGATGGCACGGAGAC 150 bp No   
R CTGTGGGTCTTGATGGTGGG
Rpl34 F ACACAAAGAAGGCAGGTGCAG 136 bp Yes   2.0
R GACCCTCCATAAGCTCTGGTTAC
Rpl32 F CACTTGATGCCTGATGGTTTCC 143 bp Yes   2.0
R GCACGCTCAACGATTTCTTTCC
Rpl14 F CAATGCCAAGATCCCTCCGTAC 167 bp Yes   2.0
R AGCTTGCTTGGCCTTCATCAG
Act F ATGCTCCAAGAGCCGTGTTTC 114 bp Yes   1.9
R CTCTCTTGCTCTGGGCTTCATC
Cyp-A F GGAGTTGAGAGCTGATGTTGTACC 100 bp Yes   1.9
R TCGGTGGAATTTGCTGTCTTGG
Ef1α F CCAGTGGCAAGACCTTATTCGAG 183 bp Yes   2.0
R TGGCTGGAGCAAAGGTAACAAC
18S F AGAAACGGCTACCACATCCA 160 bp Yes   2.0
R TGCCCTCCAATAGATCCTCG
28S F AGTGCACTTTCCTCGGGTAG 123 bp Yes   2.1
R GACGAGTCGACACTAGACGG
Gapdh F AGGAATGGCCTTCAGGGTAC 114 bp Yes [19] 2.1
R TCAGATGCTGCTTTAATGGCTG
Rps4 F TGGGTTATCGAGGGCGTAG 121 bp Yes [19] 1.9
R TCCCTTAGTTTGTGAGGACCTG
MGAL10A040115 F TGCCAACCACAGACTTCTCT 167 bp Yes   1.9
R CTTTGCGTGGTTGGAAGTCA
MGAL10A054097 F AACAACCCCAGTACCACCTT 212 bp Yes   1.9
R TCTTTAATGGCAAGCTGGGC
MGAL10A087091 F GACAACGGCCAAGGAATAGC 141 bp Yes   2.0
R TTCGTTCCTGGACCACTCTG
MGAL10A005692 F GCAGGTGTTGTTGTCATGGT 156 bp Yes   2.1
R AGAGAGAGCTTGGTTCGTGT
  1. F Forward, R Reverse, amplicon size in bp, presence of an intron within the amplified region and calculated reaction efficiencies (E) for RT-qPCR experiments