Skip to main content

Table 1 List of mmu-miRNA primer sequences

From: Small RNA sequencing and bioinformatics analysis of RAW264.7-derived exosomes after Mycobacterium Bovis Bacillus Calmette-Guérin infection

No. mmu-miRNA Primer sequence (5′ to 3′)
1 mmu-let-7a-5p RT: CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGAACTATAC
F: ACACTCCAGCTGGGTGAGGTAGTAGGTTGT
2 mmu-let-7c-5p RT: CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGAACCATAC
F: ACACTCCAGCTGGGTGAGGTAGTAGGTTGT
3 mmu-miR-25-3p RT: CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGTCAGACCG
F: ACACTCCAGCTGGGCATTGCACTTGTCTCG
4 mmu-miR-27b-3p RT: CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGGCAGAACT
F: ACACTCCAGCTGGGTTCACAGTGGCTAAG
5 mmu-miR-30a-3p RT: CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGGCTGCAAA
F: ACACTCCAGCTGGGCTTTCAGTCGGATGTT
6 mmu-miR-98-5p RT: CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGAACAATAC
F: ACACTCCAGCTGGGTGAGGTAGTAAGTTGT
7 mmu-miR-194-5p RT: CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGTCCACATG
F: ACACTCCAGCTGGGTGTAACAGCAACTCCA
8 mmu-miR-5110 RT: CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGAATTCCAC
F: ACACTCCAGCTGGGGGAGGAGGTAGAGGGTGGT
9 mmu-U6 RT: CGAATTTGCGTGTCATCCTTG
F: CTCGCTTCGGCAGCACATATAC