High-throughput detection of T-DNA insertion sites for multiple transgenes in complex genomes

BMC Genomics

Table 1 List of all primers used for library preparation

Genome-walking primers
	Name	Sequence	Tm(°C)
	PST1	cctacacgacgctcttccgatctnnnnnnnnnngttaac	50
	PST2	cctacacgacgctcttccgatctnnnnnnnnnnccatgg	60
	PST3	cctacacgacgctcttccgatctnnnnnnnnnnctcgag	56
	PST4	cctacacgacgctcttccgatctnnnnnnnnnngtcgac	56
	P5 5'overhang	cctacacgacgctcttccgatct	69
Transgene-specific primers
	Name	Sequence	Tm(°C)
Camelina sativa	LB1	agggttcctatagggtttcgctcatgtgttgagc	77
	LB2	agacgtgtgctcttccgatctgcggacgtttttaatgtactgaattaacgc	70
	RB1	tacccaacttaatcgccttgcagcacatcc	76
	RB2	agacgtgtgctcttccgatctagcctgaatggcgaatgctagagc	71
Arabidopsis thaliana	LB1	gatcgtgaagtttctcatctaagcccccatttgg	77
	LB2	agacgtgtgctcttccgatcttccagatcccccgaattaattcggc	74
	RB1	catcgtggaaaaagaagacgttccaaccacg	77
	RB2	agacgtgtgctcttccgatctagcctgaatggcgaatgctagagc	71
	P7 5'overhang	agacgtgtgctcttccgatct	65

Genome walking primers and transgene-specific primers with their calculated melting temperatures (Tm). Transgene-specific primer names correspond to both the target border (LB/RB) and PCR reaction (1/2) in which they are used. Melting temperatures were calculated using a primer concentration of 0.5 μM for genome-walking primers and 0.25 μM for transgene-specific primers and only for the “core” anticipated binding sequence, excluding the 5’ overhang nucleotides. Degenerate nucleotides are represented as “n”

ISSN: 1471-2164