Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus

  • Rebecca L Skalsky1,

    Affiliated with

    • Dana L Vanlandingham3,

      Affiliated with

      • Frank Scholle2,

        Affiliated with

        • Stephen Higgs3 and

          Affiliated with

          • Bryan R Cullen1Email author

            Affiliated with

            BMC Genomics201011:119

            DOI: 10.1186/1471-2164-11-119

            Received: 11 August 2009

            Accepted: 18 February 2010

            Published: 18 February 2010

            Abstract

            Background

            MicroRNAs (miRNAs) are small non-coding RNAs that post-transcriptionally regulate gene expression in a variety of organisms, including insects, vertebrates, and plants. miRNAs play important roles in cell development and differentiation as well as in the cellular response to stress and infection. To date, there are limited reports of miRNA identification in mosquitoes, insects that act as essential vectors for the transmission of many human pathogens, including flaviviruses. West Nile virus (WNV) and dengue virus, members of the Flaviviridae family, are primarily transmitted by Aedes and Culex mosquitoes. Using high-throughput deep sequencing, we examined the miRNA repertoire in Ae. albopictus cells and Cx. quinquefasciatus mosquitoes.

            Results

            We identified a total of 65 miRNAs in the Ae. albopictus C7/10 cell line and 77 miRNAs in Cx. quinquefasciatus mosquitoes, the majority of which are conserved in other insects such as Drosophila melanogaster and Anopheles gambiae. The most highly expressed miRNA in both mosquito species was miR-184, a miRNA conserved from insects to vertebrates. Several previously reported Anopheles miRNAs, including miR-1890 and miR-1891, were also found in Culex and Aedes, and appear to be restricted to mosquitoes. We identified seven novel miRNAs, arising from nine different precursors, in C7/10 cells and Cx. quinquefasciatus mosquitoes, two of which have predicted orthologs in An. gambiae. Several of these novel miRNAs reside within a ~350 nt long cluster present in both Aedes and Culex. miRNA expression was confirmed by primer extension analysis. To determine whether flavivirus infection affects miRNA expression, we infected female Culex mosquitoes with WNV. Two miRNAs, miR-92 and miR-989, showed significant changes in expression levels following WNV infection.

            Conclusions

            Aedes and Culex mosquitoes are important flavivirus vectors. Recent advances in both mosquito genomics and high-throughput sequencing technologies enabled us to interrogate the miRNA profile in these two species. Here, we provide evidence for over 60 conserved and seven novel mosquito miRNAs, expanding upon our current understanding of insect miRNAs. Undoubtedly, some of the miRNAs identified will have roles not only in mosquito development, but also in mediating viral infection in the mosquito host.

            Background

            Culex and Aedes mosquitoes are members of the Culicinae subfamily that vector positive-sense RNA viruses from the family Flaviviridae. Many flaviviruses, such as West Nile virus (WNV), dengue virus (DENV), and yellow fever virus (YFV), are highly pathogenic in humans and pose an important health problem worldwide [1]. Each year, an estimated 50 million human cases of dengue fever occur due to infection with DENV. Since the introduction of WNV to the United States in 1999, over 28,000 cases have been reported to the CDC, with approximately 3,000 cases annually http://​CDC.​gov. Culex mosquitoes are primarily responsible for the transmission of WNV to humans (reviewed in [2]), although WNV has also been isolated from Aedes albopictus in the eastern United States (reviewed in [3]). Virus transmission from Cx. quinquefasciatus occurs as early as five days following an infectious blood meal [4], and virus can persist as long as four weeks in the midguts and salivary glands of infected mosquitoes [5, 6].

            Both Culex and Aedes mosquitoes are prevalent in tropical and subtropical regions around the world. Recently, Ae. albopictus has emerged as a major vector for Chikungunya virus, an alphavirus, in regions bordering the western Indian Ocean [7, 8]. Ae. albopictus is also considered a secondary vector for dengue virus serotypes 1-4 (DENV1-4) and YFV, which are predominantly transmitted to humans by a mosquito from the same genus, Ae. aegypti. Ae. albopictus can potentially vector at least 22 known arboviruses (reviewed in [3]).

            Of the over 3,000 mosquito species worldwide, microRNAs (miRNAs) have so far only been described in two species of African malaria mosquitoes, Anopheles gambiae and Anopheles stephensi, using direct cloning and computational methods. Over 55 miRNAs have been described for Anopheles mosquitoes, at least 49 of which have orthologs in Drosophila melanogaster and other insects [912]. The functions of these miRNAs in mosquitoes, and the identities of their mRNA targets, are not yet known.

            miRNAs are a class of small, non-coding RNAs, from 19-24 nt in length, that post-transcriptionally regulate gene expression by binding to complementary regions in, primarily, the 3' untranslated region (3' UTR) of target messenger RNAs. First identified in Caenorhabditis elegans, miRNAs have now been found in a wide variety of organisms including insects, vertebrates, and plants [1315]. Over 10,800 miRNAs are currently annotated in miRBase, many of which are conserved from worms to flies to humans [9]. In humans, miRNAs are predicted to regulate as much as one-third of all mRNAs [16], and thus, represent an important component in managing biological processes.

            Much of what we understand about insect miRNAs comes from studies in the fruit fly D. melanogaster. D. melanogaster miRNAs were originally identified via direct cloning of small RNA molecules and many of these miRNAs exhibited significant sequence conservation with miRNAs expressed in C. elegans [17]. At present, 147 different miRNAs have been annotated for D. melanogaster, the majority of which have orthologous sequences in other winged insects [9]. With the identification of new miRNAs in a number of organisms, evolutionary sequence conservation has become a hallmark of miRNA biology [12, 15, 18, 19].

            Differential miRNA expression throughout the various stages of the Drosophila life cycle has revealed a role for miRNAs in important cellular processes such as apoptosis, cell division, and differentiation [2022]. Additionally, miRNA expression profiles change in response to stress, inflammation, and infection [11, 19]. For example, in Anopheles mosquitoes, expression levels of four miRNAs are altered during the response to Plasmodium infection [11].

            The process of miRNA biogenesis is conserved, initiating with the cleavage of long, endogenous nuclear primary miRNA transcripts, ranging from hundreds to thousands of nucleotides in length, into pre-miRNAs [23, 24]. Two proteins are required for this processing in insects, the RNAse III enzyme Drosha and its binding partner Pasha, which together excise the ~60 nt pre-miRNA hairpin from the pri-miRNA [25]. The pre-miRNA is then exported to the cytoplasm and processed by a second RNAse III enzyme called Dicer-1 to yield the ~22 bp miRNA:miRNA* duplex intermediate [13]. Mature miRNAs are selectively loaded into the multi-component RNA-induced silencing complex (RISC) which contains members of the Argonaute family (Ago). In Drosophila, strand selection has been shown to depend on the intrinsic structure of the miRNA:miRNA* duplex, which facilitates sorting into either Ago1- or Ago2-containing RISCs [26, 27]. Recent comparative genomics studies have shown that the Anopheles, Aedes, and Culex mosquito genomes all encode orthologs of key proteins involved in the miRNA, as well as small interfering RNA (siRNA) and piwi RNA (piRNA), regulatory pathways [28]. Mature miRNAs are used as guide RNAs to direct RISC to complementary regions of mRNAs, resulting in the inhibition of translation and/or target mRNA degradation. Important for this targeting are nucleotides 2-8 from the 5' end of the mature miRNA, known as the "seed" [29, 30]. Many studies have shown that miRNAs can target 3'UTRs of mRNAs [31, 32]; however, recent studies have also revealed functional target sites within the ORFs of mRNAs [33, 34].

            Recent advances in mosquito genomics, such as the sequencing of the genomes of three mosquito species, Ae. aegypti, Cx. quinquefasciatus, and An. gambiae [35], together with technological advances in small RNA cloning methods, enabled us to interrogate the miRNA repertoire in two flavivirus mosquito vectors. In this study, we used deep sequencing to identify over 60 conserved and several novel miRNAs in Cx. quinquefasciatus mosquitoes and an Ae. albopictus cell line, C7/10, commonly used for in vitro flavivirus studies. We additionally investigated the effects of flavivirus infection on miRNA expression and found that miR-92 and miR-989 are significantly changed in response to WNV infection.

            Results and Discussion

            Deep sequencing of small RNAs

            To identify miRNAs in Culex and Aedes mosquitoes, we isolated small RNAs (18-28 nt) from C7/10 Ae. albopictus cells and blood-fed, female Cx. quinquefasciatus mosquitoes. Small RNA libraries were subjected to Illumina-based high-throughput sequencing. After filtering for linker sequences, and removing ambiguous reads, a total of 1,852,398 reads for Ae. albopictus cells and 1,790,474 reads for Cx. quinquefasciatus mosquitoes, representing 41,056 and 281,918 non-redundant sequences, respectively, were obtained (Figure 1D). >90% of final reads for Ae. albopictus and >50% of reads for Cx. quinquefasciatus exhibited the predominantly ~22 nt size expected for insect miRNAs (Figure 1A, B).
            http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-11-119/MediaObjects/12864_2009_Article_2713_Fig1_HTML.jpg
            Figure 1

            Deep sequencing of small RNA populations in Ae. albopictus C7/10 cells and Cx. quinquefasciatus mosquitoes. Size distributions of small RNA libraries (18-28 nt) from A) C7/10 cells (Aedes) and B) Cx. quinquefasciatus (Culex). C) Frequencies of read counts for individual, conserved miRNAs present in C7/10 cells and Culex mosquitoes. Expression levels, based on read counts, of individual miRNAs are separated into several ranges and span over 5 orders of magnitude. D) Breakdown of the total number of reads obtained for each library. The number of reads mapping to miRNA and miRNA* strands is reported.

            Most mosquito miRNAs are orthologs of known insect miRNAs

            We aligned sequencing reads to known miRNAs and miRNA* strands present in miRBase v14. 1,541,048 reads from the Ae. albopictus library corresponded to 53 distinct pre-miRNAs (61 miRNAs) (Table 1). For the Cx. quinquefasciatus library, 382,878 reads aligned to sequences present in miRBase, representing 69 distinct pre-miRNAs (74 miRNAs) (Table 2). For each miRNA, the sequence with the greatest number of reads was annotated and named according to the most similar match in miRBase [9]. In addition to mature miRNAs, we identified a number of miRNA* strands (Figure 1D, Tables 1, 2), which accounted for < 0.2% of the 20-24 nt population. 21 and 33 distinct miRNA* strands were identified in Ae. albopictus and Cx. quinquefasciatus respectively, and are orthologous to miRNA* strands in other winged insects (Tables 1, 2).
            Table 1

            miRNAs identified in Ae. albopictus C7/10 cells and predicted in Ae. aegypti.

            C710

            # miRNA

            # miRNA*

            Sequence

            Length

            aga

            ame

            dme

            Ae. aegypti

            Start

            End

            Strand

            184

            1487481

            0

            UGGACGGAGAACUGAUAAGGGC

            22

            Y

            Y

            Y

            1.496

            143378

            143399

            Minus

            275

            23841

            78

            UCAGGUACCUGAAGUAGCGC

            20

            Y

            Y

            Y

            1.24

            486591

            486610

            Plus

            277

            4453

            7

            UAAAUGCACUAUCUGGUACGAC

            22

            Y

            Y

            Y

            1.265

            508860

            508881

            Plus

            9

            4085

            602

            UCUUUGGUAUUCUAGCUGUAGA

            22

            Y

            Y

            Y

            1.785

            186231

            186252

            Plus

            8-3p

            3002

            -

            UAAUACUGUCAGGUAAAGAUGUC

            23

            Y

            Y

            Y

            1.411

            876091

            876113

            Plus

            252.1

            1608

            13

            UAAGUACUAGUGCCGCAGGAG

            21

            Y

            Y

            Y

            1.56

            1580060

            1580080

            Minus

            bantam-5p

            1384

            -

            CCGGUUUUCAUUUUCGAUCUGAC

            23

            Y

            Y

            Y

            1.49

            157893

            157915

            Minus

            71

            1246

            17

            AGAAAGACAUGGGUAGUGAGAU

            22

            ?

            Y

            ?

            1.268

            889428

            889449

            Minus

            8-5p

            1244

            -

            CAUCUUACCGGGCAGCAUUAGA

            22

            Y

            Y

            Y

            1.411

            876052

            876073

            Plus

            276-1

            1209

            4

            UAGGAACUUCAUACCGUGCUC

            21

            Y

            Y

            Y

            1.5

            2769510

            2769530

            Minus

            276-2

            -

            -

            UAGGAACUUCAUACCGUGCUC

            21

            Y

            Y

            Y

            1.134

            39026

            39046

            Plus

            317-1

            1118

            0

            UGAACACAGCUGGUGGUAUCU

            21

            Y

            Y

            Y

            1.265

            429503

            429523

            Plus

            317-2

            -

            -

            UGAACACAGCUGGUGGUAUCU

            21

            Y

            Y

            Y

            1.153

            2154717

            2154737

            Minus

            283

            947

            0

            CAAUAUCAGCUGGUAAUUCUGGGC

            24

            Y

            Y

            Y

            1.68

            2729393

            2729416

            Minus

            252.2

            888

            -

            CUAAGUACUAGUGCCGCAGGAG

            22

            Y

            Y

            Y

            1.56

            1580060

            1580081

            Minus

            let-7

            650

            0

            UGAGGUAGUUGGUUGUAUAGU

            21

            Y

            Y

            Y

            1.43

            1156331

            1156351

            Plus

            2

            708

            1

            UAUCACAGCCAGCUUUGAAGAGC

            23

            Y

            Y

            Y

            1.268

            888597

            888619

            Minus

            998

            561

            0

            UAGCACCAUGAGAUUCAGC

            19

            ?

            ?

            Y

            1.744

            322338

            322356

            Plus

            92b

            530

            0

            AAUUGCACUUGUCCCGGCCUG

            21

            Y

            Y

            Y

            1.116

            1319201

            1319221

            Plus

            1889-3p

            478

            -

            CACGUUACAGAUUGGGGUUUCC

            22

            Y

            ?

            ?

            1.68

            2720796

            2720817

            Minus

            bantam-3p

            475

            -

            UGAGAUCAUUUUGAAAGCUGAU

            22

            Y

            Y

            Y

            1.49

            1579555

            1579576

            Minus

            306

            454

            81

            UCAGGUACUGAGUGACUCUCAG

            22

            Y

            ?

            Y

            1.785

            213078

            213099

            Plus

            281

            398

            1

            AAGAGAGCUAUCCGUCGAC

            19

            Y

            Y

            Y

            1.957

            134462

            134480

            Plus

            1889-5p

            378

            -

            UAAUCUCAAAUUGUAACAGUGG

            22

            Y

            ?

            ?

            1.68

            2720896

            2720917

            Minus

            980

            309

            6

            UAGCUGCCUAGUGAAGGGC

            19

            ?

            ?

            Y

            1.23

            1043069

            1043087

            Plus

            278

            286

            53

            ACGGACGAUAGUCUUCAGCGGCC

            23

            Y

            Y

            Y

            1.16

            3596269

            3596291

            Plus

            989

            242

            0

            UGUGAUGUGACGUAGUGGUAC

            21

            Y

            ?

            Y

            1.115

            804187

            804207

            Minus

            14

            247

            0

            UCAGUCUUUUUCUCUCUCCUAU

            22

            Y

            Y

            Y

            1.249

            1089019

            1089040

            Minus

            11

            222

            31

            CAUCACAGUCUGAGUUCUUGCU

            22

            Y

            ?

            Y

            1.744

            322062

            322083

            Plus

            190

            210

            0

            AGAUAUGUUUGAUAUUCUUGGUUG

            24

            Y

            Y

            Y

            1.195

            82254

            82277

            Minus

            1

            169

            0

            UGGAAUGUAAAGAAGUAUGGAG

            22

            Y

            Y

            Y

            1.812

            291373

            291394

            Plus

            34

            147

            1

            UGGCAGUGUGGUUAGCUGGUUG

            22

            Y

            ?

            Y

            1.265

            509536

            509557

            Plus

            1890

            123

            0

            UGAAAUCUUUGAUUAGGUCUGG

            22

            Y

            ?

            ?

            1.204

            1733356

            1733377

            Plus

            988

            118

            24

            CCCCUUGUUGCAAACCUCACGC

            22

            Y

            ?

            Y

            1.442

            623057

            623078

            Minus

            957

            99

            0

            UGAAACCGUCCAAAACUGAGGC

            22

            Y

            ?

            Y

            1.7

            464339

            464360

            Plus

            305

            96

            4

            AUUGUACUUCAUCAGGUGCUCUGG

            24

            Y

            Y

            Y

            1.24

            495601

            495624

            Plus

            996

            88

            0

            UGACUAGAUUACAUGCUCGUC

            21

            Y

            Y

            Y

            1.437

            567507

            567527

            Minus

            87

            79

            0

            GUGAGCAAAUUUUCAGGUGUGU

            22

            Y

            Y

            Y

            1.36

            1010846

            1010867

            Plus

            12

            68

            3

            UGAGUAUUACAUCAGGUACUGGU

            23

            Y

            Y

            Y

            1.68

            2720468

            2720490

            Minus

            13

            57

            1

            UAUCACAGCCAUUUUGACGAGUU

            23

            Y

            Y

            Y

            1.268

            888744

            888766

            Minus

            92a

            44

            0

            UAUUGCACUUGUCCCGGCC

            19

            Y

            Y

            Y

            1.116

            1267254

            1267272

            Plus

            33

            40

            0

            GUGCAUUGUAGUUGCAUUGCA

            21

            ?

            Y

            Y

            1.487

            351656

            351676

            Plus

            279

            36

            2

            UGACUAGAUCCACACUCAUUAA

            22

            Y

            Y

            Y

            1.437

            572258

            572279

            Minus

            79

            33

            6

            GCUUUGGCGCUUUAGCUGUAUGA

            23

            Y

            Y

            Y

            1.785

            213277

            213299

            Plus

            263

            32

            0

            AAUGGCACUGGAAGAAUUCACGG

            23

            Y

            Y

            Y

            1.981

            164999

            165021

            Minus

            7

            32

            0

            UGGAAGACUAGUGAUUUUGUUGU

            23

            Y

            Y

            Y

            1.1359

            46041

            46063

            Plus

            **2945

            32

            0

            UGACUAGAGGCAGACUCGUUUA

            22

            Y

            ?

            ?

            1.43

            481083

            481105

            Plus

            100-5p

            30

            -

            AACCCGUAGAUCCGAACUUGUG

            22

            Y

            Y

            Y

            1.43

            1142184

            1142205

            Plus

            100-3p

            25

            -

            CAAGAACGGAUGUAUGGGAUUC

            22

            Y

            Y

            Y

            1.43

            1142224

            1142245

            Plus

            970

            21

            0

            UCAUAAGACACACGCGGCUAU

            21

            Y

            ?

            Y

            1.229

            1045875

            1045895

            Plus

            210.1

            13

            0

            CUUGUGCGUGUGACAACGG

            19

            Y

            Y

            Y

            1.512

            515650

            515668

            Plus

            999

            14

            0

            UGUUAACUGUAAGACUGUGUCU

            22

            ?

            ?

            Y

            1.100.

            2315145

            2315166

            Plus

            308

            16

            4

            CGCGGUAUAUUCUUGUGGCUUG

            22

            Y

            ?

            Y

            1.107

            508980

            509001

            Plus

            125

            7

            3

            UCCCUGAGACCCUAACUUGUGA

            22

            Y

            Y

            Y

            1.43

            1156615

            1156636

            Plus

            210.2

            6

            0

            UUGUGCGUGUGACAACGGCUAU

            22

            Y

            Y

            Y

            1.512

            515646

            515667

            Plus

            307

            6

            0

            CACAACCUCCUUGAGUGAGCGA

            22

            Y

            ?

            Y

            1.16

            1859430

            1859451

            Minus

            1000-1

            6

            0

            AUAUUGUCCUGUCACAGCAGU

            21

            Y

            Y

            Y

            1.187

            325478

            325498

            Plus

            1000-2

            -

            -

            AUAUUGUCCUGUCACAGCAGU

            21

            Y

            Y

            Y

            1.3798

            224

            244

            Minus

            375

            4

            0

            UUUGUUCGUUUGGCUCGAGUUA

            22

            Y

            Y

            Y

            1.309

            1318752

            1318773

            Minus

            309-1

            4

            -

            UCACUGGGCAAAGUUUGUCGCA

            22

            Y

            ?

            Y

            1.15

            907938

            907959

            Plus

            309-2

            -

            -

            UCACUGGGCAAAGUUUGUCGCA

            22

            Y

            ?

            Y

            1.602

            94088

            94109

            Plus

            932

            3

            -

            UGCAAGCAAUGUGGAAGUGAAG

            22

            ?

            Y

            Y

            1.1064

            154192

            154213

            Minus

            315

            2

            0

            UUUUGAUUGUUGCUCAGAAAGC

            22

            Y

            Y

            Y

            1.612

            104143

            104164

            Plus

            927

            1

            0

            CAAAGCGUUUGGAUUCUGAAAC

            22

            Y

            Y

            Y

            1.26

            2065461

            2065482

            Plus

            **2943

            1

            0

            UUAAGUAGGCACUUGCAGGC

            20

            Y

            ?

            ?

            1.348

            212450

            212470

            Plus

            1891-1

            predicted

             

            UGAGGAGUUAAUUUGCGUGUUU

            22

            Y

            ?

            ?

            1.199

            1109750

            1109771

            Minus

            1891-2

            predicted

             

            UGAGGAGUUAAUUUGCGUGUUU

            22

            Y

            ?

            ?

            1.466

            72802

            72823

            Plus

            1175

            predicted

             

            AAGUGGAGUAGUGGUCUCAUCG

            22

            Y

            ?

            ?

            1.125

            1648037

            1648058

            Plus

            1174

            predicted

             

            UCAGAUCUACUUAAUACCCAU

            21

            Y

            ?

            ?

            1.125

            1647921

            1647941

            Plus

            993

            predicted

             

            UACCCUGUAGUUCCGGGCUUUU

            22

            Y

            Y

            Y

            1.056

            256798

            256819

            Plus

            981

            predicted

             

            UUCGUUGUCGACGAAACCUGCA

            22

            Y

            Y

            Y

            1.127

            638380

            638401

            Minus

            965

            predicted

             

            UAAGCGUAUAGCUUUUCCCAUU

            22

            Y

            ?

            Y

            1.51

            2008701

            2008722

            Plus

            316

            predicted

             

            UGUCUUUUUCCGCUUACUGCCG

            22

            ?

            Y

            Y

            1.289

            891327

            891348

            Minus

            285

            predicted

             

            UAGCACCAUUCGAAAUCAGUAC

            22

            ?

            ?

            Y

            1.26

            3339153

            3339174

            Minus

            137-1

            predicted

             

            UAUUGCUUGAGAAUACACGUAG

            22

            Y

            Y

            Y

            1.1191

            97844

            97865

            Plus

            137-2

            predicted

             

            UAUUGCUUGAGAAUACACGUAG

            22

            Y

            Y

            Y

            1.137

            260684

            260705

            Minus

            133

            predicted

             

            UUGGUCCCCUUCAACCAGCUGU

            22

            Y

            Y

            Y

            1.778

            350306

            350327

            Minus

            124

            predicted

             

            UAAGGCACGCGGUGAAUGC

            19

            Y

            Y

            Y

            1.6

            1664623

            1664641

            Minus

            31

            predicted

             

            UGGCAAGAUGUUGGCAUAGCUGA

            23

            ?

            Y

            Y

            1.636

            483257

            483279

            Minus

            10

            predicted

             

            ACCCUGUAGAUCCGAAUUUGUU

            22

            Y

            Y

            Y

            1.44

            813557

            813578

            Plus

            iab-4-1

            predicted

             

            ACGUAUACUGAAUGUAUCCUGA

            22

            Y

            Y

            Y

            1.708

            50265

            50286

            Plus

            iab-4-2

            predicted

             

            ACGUAUACUGAAUGUAUCCUGA

            22

            Y

            Y

            Y

            1.423

            763526

            763547

            Minus

            2940

            125253

            4125

            UGGUUUAUCUUAUCUGUCGAGGC

            23

            ?

            ?

            ?

            1.222

            643960

            643982

            Plus

            2765

            1162

            0

            UGGUAACUCCACCACCGUUGGC

            22

            Y

            ?

            ?

            1.11

            5248310

            5248331

            Plus

            2951

            1136

            28

            AAGAGCUCAGUACGCAGGGG

            20

            ?

            ?

            ?

            multiple

               

            2941-1

            9

            0

            UAGUACGGCUAGAACUCCACGG

            22

            ?

            ?

            ?

            1.385

            413147

            413168

            Minus

            2941-2

            -

            -

            UAGUACGGCUAGAACUCCACGG

            22

            ?

            ?

            ?

            1.385

            413451

            413472

            Minus

            aga = An. gambiae; ame = Ap. mellifera; dme = D. melanogaster.

            Top group: miRNAs and miRNA* strands identified by deep sequencing

            Middle group: predicted miRNAs identified in Cx. quinquefasciatus but absent from C7/10 cells were cross-referenced with the Ae. aegypti (AaegL1)

            Bottom group: novel miRNAs identified in this study. miR-2765 (not present in miRBase v14) has recently been identified in Bombyx mori.

            ** novel miRNAs (not present in miRBase v14) recently identified in Ae. aegypti mosquitoes while this manuscript was under review

            Table 2

            miRNAs identified in Cx. quinquefasciatus adult female mosquitoes.

            Culex

            # miRNA

            # miRNA*

            Sequence

            Length

            aga

            ame

            dme

            supercontig

            Start

            End

            Strand

            184

            107190

            0

            UGGACGGAGAACUGAUAAGGGC

            22

            Y

            Y

            Y

            3.567

            240312

            240333

            Minus

            317-1

            71313

            2

            UGAACACAGCUGGUGGUAUCU

            21

            Y

            Y

            Y

            3.36

            1133209

            1133229

            Plus

            317-2

            -

            -

            UGAACACAGCUGGUGGUAUCU

            21

            Y

            Y

            Y

            3.36

            1134875

            1134895

            Plus

            277

            58628

            0

            UAAAUGCACUAUCUGGUACGAC

            22

            Y

            Y

            Y

            3.36

            1153785

            1153806

            Plus

            1

            36084

            0

            UGGAAUGUAAAGAAGUAUGGAG

            22

            Y

            Y

            Y

            3.78

            246250

            246271

            Plus

            989

            23667

            0

            UGUGAUGUGACGUAGUGGUAC

            21

            Y

            ?

            Y

            3.315

            321364

            321384

            Plus

            275

            13910

            2

            UCAGGUACCUGAAGUAGCGC

            20

            Y

            Y

            Y

            3.291

            329815

            329834

            Plus

            957

            11682

            0

            UGAAACCGUCCAAAACUGAGGC

            22

            Y

            ?

            Y

            3.787

            29593

            29614

            Plus

            8-3p

            10950

            -

            UAAUACUGUCAGGUAAAGAUGU

            22

            Y

            Y

            Y

            3.40

            815865

            815886

            Minus

            281

            9322

            95

            AAGAGAGCUAUCCGUCGACAGU

            22

            Y

            Y

            Y

            3.64

            99744

            99765

            Plus

            Let-7

            9266

            5

            UGAGGUAGUUGGUUGUAUAGU

            21

            Y

            Y

            Y

            3.4

            280610

            280630

            Plus

            34

            6301

            3

            UGGCAGUGUGGUUAGCUGGUU

            21

            Y

            Y

            Y

            3.36

            1154478

            1154498

            Plus

            263

            3749

            2

            AAUGGCACUGGAAGAAUUCACGG

            23

            Y

            Y

            Y

            3.219

            351848

            351870

            Minus

            252-1

            3157

            2

            (C)UAAGUACUAGUGCCGCAGGAG

            21

            Y

            Y

            Y

            3.1787

            6836

            6856

            Minus

            252-2

            -

            -

            (C)UAAGUACUAGUGCCGCAGGAG

            21

            Y

            Y

            Y

            3.975

            115594

            115614

            Plus

            87

            2364

            0

            GUGAGCAAAUUUUCAGGUGUGU

            22

            Y

            Y

            Y

            3.431

            379788

            379809

            Plus

            71

            2232

            14

            AGAAAGACAUGGGUAGUGAGAU

            22

            ?

            Y

            ?

            3.366

            117552

            117573

            Minus

            bantam-5p

            1459

            -

            CCGGUUUUCAUUUUCGAUCUGAC

            21

            Y

            Y

            Y

            3.65

            199737

            199759

            Minus

            9

            1138

            440

            UCUUUGGUAUUCUAGCUGUAGA

            22

            Y

            Y

            Y

            3.83

            64733

            64754

            Plus

            11

            888

            5

            CAUCACAGUCUGAGUUCUUGCU

            22

            Y

            ?

            Y

            3.153

            639669

            639690

            Minus

            276-1

            860

            2

            UAGGAACUUCAUACCGUGCUCU

            22

            Y

            Y

            Y

            3.136

            340911

            340932

            Plus

            276-2

            -

            -

            UAGGAACUUCAUACCGUGCUCU

            22

            Y

            Y

            Y

            3.136

            541192

            541213

            Plus

            276-3

            -

            -

            UAGGAACUUCAUACCGUGCUCU

            22

            Y

            Y

            Y

            3.2457

            930

            951

            Plus

            210.1

            720

            5

            UUGUGCGUGUGACAACGGCUAU

            22

            Y

            Y

            Y

            3.549

            157657

            157678

            Minus

            927

            703

            21

            CAAAGCGUUUGGAUUCUGAAAC

            22

            Y

            Y

            Y

            3.11

            560282

            560302

            Plus

            bantam-3p

            689

            -

            UGAGAUCAUUUUGAAAGCUGA

            21

            Y

            Y

            Y

            3.65

            199698

            199718

            Minus

            8-5p

            594

            -

            CAUCUUACCGGGCAGCAUUAGA

            22

            Y

            Y

            Y

            3.40

            815904

            815925

            Minus

            2

            547

            2

            UAUCACAGCCAGCUUUGAAGAGC

            23

            Y

            Y

            Y

            3.366

            116861

            116883

            Minus

            998

            434

            0

            UAGCACCAUGAGAUUCAGC

            19

            ?

            ?

            Y

            3.153

            639527

            639545

            Minus

            210.2

            405

            -

            CUUGUGCGUGUGACAACGGCUAU

            23

            Y

            Y

            Y

            3.549

            157657

            157679

            Minus

            14

            358

            0

            UCAGUCUUUUUCUCUCUCCUAU

            22

            Y

            Y

            Y

            3.676

            52251

            52272

            Minus

            285

            324

            5

            UAGCACCAUUCGAAAUCAGUAC

            22

            ?

            ?

            Y

            3.98

            262290

            262311

            Minus

            1890

            287

            0

            UGAAAUCUUUGAUUAGGUCUGG

            22

            Y

            ?

            ?

            3.64

            982786

            982807

            Minus

            190-1

            231

            0

            AGAUAUGUUUGAUAUUCUUGGUUG

            24

            Y

            Y

            Y

            3.181

            347953

            347976

            Minus

            190-2

            -

            -

            AGAUAUGUUUGAUAUUCUUGGUUG

            24

            Y

            Y

            Y

            3.351

            105098

            105121

            Minus

            283

            224

            0

            CAAUAUCAGCUGGUAAUUCUGGG

            23

            Y

            Y

            Y

            3.57

            559462

            559484

            Plus

            7

            192

            0

            UGGAAGACUAGUGAUUUUGUUGU

            23

            Y

            Y

            Y

            3.1

            3357390

            3357412

            Minus

            100

            170

            43

            AACCCGUAGAUCCGAACUUGUG

            22

            Y

            Y

            Y

            3.4

            271414

            271435

            Plus

            1891

            167

            1

            UGAGGAGUUAAUUUGCGUGUUU

            22

            Y

            ?

            ?

            3.829

            180383

            180404

            Minus

            999

            165

            0

            UGUUAACUGUAAGACUGUGUCU

            22

            ?

            ?

            Y

            3.14

            96917

            96938

            Plus

            309

            33

            1

            UCACUGGGCAUAGUUUGUCGCAU

            23

            Y

            ?

            Y

            3.145

            66041

            66063

            Minus

            375

            144

            0

            UUUGUUCGUUUGGCUCGAGUUAC

            23

            Y

            Y

            Y

            3.455

            42584

            42605

            Plus

            306

            143

            65

            UCAGGUACUGAGUGACUCUCAG

            22

            Y

            ?

            Y

            3.83

            80436

            80457

            Plus

            125

            140

            7

            UCCCUGAGACCCUAACUUGUGA

            22

            Y

            Y

            Y

            3.4

            280975

            280996

            Plus

            315

            131

            0

            UUUUGAUUGUUGCUCAGAAAGC

            22

            Y

            Y

            Y

            3.438

            61926

            61947

            Plus

            124

            105

            0

            UAAGGCACGCGGUGAAUGC

            19

            Y

            Y

            Y

            3.8

            2074772

            2074790

            Plus

            92b

            96

            0

            AAUUGCACUUGUCCCGGCCUG

            21

            Y

            Y

            Y

            3.722

            164913

            164933

            Minus

            1889-5p

            89

            -

            UAAUCUCAAAUUGUAACAGUGG

            22

            Y

            ?

            ?

            3.57

            562555

            562576

            Plus

            981-1

            82

            0

            UUCGUUGUCGACGAAACCUGCA

            22

            Y

            Y

            Y

            3.431

            144482

            144503

            Plus

            981-2

            -

            -

            UUCGUUGUCGACGAAACCUGCA

            22

            Y

            Y

            Y

            3.431

            151371

            151392

            Plus

            12

            80

            2

            UGAGUAUUACAUCAGGUACUGGU

            23

            Y

            Y

            Y

            3.57

            563009

            563031

            Plus

            31

            76

            2

            UGGCAAGAUGUUGGCAUAGCUGA

            23

            ?

            Y

            Y

            3.559

            256577

            256599

            Minus

            10

            59

            40

            CAAAUUCGGUUCUAGAGAGGUUU

            23

            Y

            Y

            Y

            3.12

            96000

            96022

            Minus

            1174

            58

            0

            CUGGGUAUUUUAGAUCAUCGGC

            22

            Y

            ?

            ?

            3.86

            865901

            865922

            Plus

            **2945

            52

            0

            UGACUAGAGGCAGACUCGUUU

            20

            Y

            ?

            ?

            3.4

            184461

            184481

            Plus

            1000

            49

            0

            AUAUUGUCCUGUCACAGCAGU

            21

            Y

            Y

            Y

            3.153

            102853

            102873

            Minus

            13

            37

            3

            UAUCACAGCCAUUUUGACGAGU

            22

            Y

            Y

            Y

            3.366

            116994

            117015

            Minus

            996

            36

            2

            UGACUAGAUUACAUGCUCGU

            20

            Y

            Y

            Y

            3.19

            1437010

            1437029

            Minus

            137

            33

            0

            UAUUGCUUGAGAAUACACGUAG

            22

            Y

            Y

            Y

            3.1714

            27566

            27587

            Minus

            133

            32

            0

            UUGGUCCCCUUCAACCAGCUGU

            22

            Y

            Y

            Y

            3.1189

            55748

            55769

            Plus

            1175

            35

            7

            AAGUGGAGUAGUGGUCUCAUCG

            22

            Y

            ?

            ?

            3.86

            866116

            866137

            Plus

            279

            26

            21

            UGACUAGAUCCACACUCAUUAA

            22

            Y

            Y

            Y

            3.19

            1441123

            1441144

            Minus

            92a

            24

            -

            UAUUGCACUUGUCCCGGCCUAU

            22

            Y

            Y

            Y

            3.722

            174912

            174933

            Minus

            932-3p

            22

            -

            UGCAAGCAAUGUGGAAGUGA

            22

            ?

            Y

            Y

            3.261

            301413

            301432

            Minus

            970

            20

            0

            UCAUAAGACACACGCGGCUAU

            21

            Y

            ?

            Y

            3.495

            35970

            35990

            Plus

            316

            18

            0

            UGUCUUUUUCCGCUUACUGCCG

            22

            ?

            Y

            Y

            3.496

            152508

            152529

            Minus

            305

            17

            1

            AUUGUACUUCAUCAGGUGCUCU

            22

            Y

            Y

            Y

            3.291

            339134

            339155

            Plus

            **2944a-1

            13

            1

            GAAGGAACUUCUGCUGUGAUC

            21

            Y

            ?

            ?

            3.66

            328681

            328701

            Minus

            **2944a-2

            -

            -

            GAAGGAACUUCUGCUGUGAUC

            21

            Y

            ?

            ?

            3.145

            66240

            66260

            Minus

            988

            11

            5

            CCCUUGUUGCAAACCUCACGC

            21

            Y

            ?

            Y

            3.791

            14331

            14351

            Plus

            932-5p

            11

            -

            UCAAUUCCGUAGUGCAUUGCAG

            22

            ?

            Y

            Y

            3.261

            301450

            301471

            Minus

            1889-3p

            7

            -

            CACGUUACAGAUUGGGGUUUCC

            22

            Y

            ?

            ?

            3.57

            562642

            562663

            Plus

            993

            4

            1

            UACCCUGUAGUUCCGGGCUUUU

            22

            Y

            Y

            Y

            3.12

            55487

            55508

            Plus

            278

            3

            0

            UCGGUGGGACUUUCGUCCGUUU

            22

            Y

            Y

            Y

            3.16

            1026212

            1026233

            Plus

            965

            2

            0

            UAAGCGUAUAGCUUUUCCCAUU

            22

            Y

            ?

            Y

            3.48

            484177

            484198

            Plus

            Iab-4

            2

            1

            ACGUAUACUGAAUGUAUCCUGA

            22

            Y

            Y

            Y

            3.12

            681163

            681184

            Plus

            980

            2

            0

            UAGCUGCCUAGUGAAGGGC

            19

            ?

            ?

            Y

            3.263

            352922

            352940

            Plus

            308

            3

            1

            CGCAGUAUAUUCUUGUGGCUUG

            22

            Y

            ?

            Y

            3.98

            764133

            764154

            Plus

            79

            2

            0

            GCUUUGGCGCUUUAGCUGUAUGA

            23

            Y

            Y

            Y

            3.83

            80591

            80613

            Plus

            **2943

            1

            0

            UAAGUAGGCACUUGCAGGCAAAG

            23

            Y

            ?

            ?

            3.121

            94164

            94186

            Minus

            **2944b-1

            1

            0

            GAAGGAACUCCCGGUGUGAUAU

            22

            Y

            ?

            ?

            3.66

            328838

            328859

            Minus

            **2944b-2

            -

            -

            GAAGGAACUCCCGGUGUGAUAU

            22

            Y

            ?

            ?

            3.145

            66389

            66410

            Minus

            33

            predicted

             

            GUGCAUUGUAGUUGCAUUGCA

            21

            ?

            Y

            Y

            3.1258

            69381

            69401

            Minus

            2951

            162309

            342

            AAGAGCUCAGCACGCAGGGGUGGC

            24

            ?

            ?

            ?

            multiple

               

            2952

            2203

            -

            UAGUACGGCCAUGACUGAGGGC

            22

            ?

            ?

            ?

            3.5

            753922

            753943

            Minus

            2941-1

            1221

            3

            UAGUACGGCUAGAACUCCACGG

            22

            ?

            ?

            ?

            3.5

            753643

            753664

            Minus

            2941-2

            -

            1

            UAGUACGGCUAGAACUCCACGG

            22

            ?

            ?

            ?

            3.5

            753797

            753818

            Minus

            aga = An. gambiae; ame = Ap. mellifera; dme = D. melanogaster.

            Top group: miRNAs and miRNA* strands identified by deep sequencing

            Middle group: predicted miR-33 was identified in C7/10 cells but absent from Cx. quinquefasciatus. miR-33 was cross-referenced with the Cx. quinquefasciatus genome.

            Bottom group: novel miRNAs identified in this study.

            ** novel miRNAs (not present in miRBase v14) recently identified in Ae. aegypti mosquitoes while this manuscript was under review

            miRNA expression levels, based on the number of reads obtained, varied greatly, spanning over five orders of magnitude for Cx. quinquefasciatus and six orders of magnitude for Ae. albopictus (Figure 1C, Tables 1, 2). For both species, the majority of miRNAs (>70%) were sequenced between 10 and 10,000 times (Figure 1C). miR-184 was the most highly expressed miRNA in both species, represented by 1,487,481 reads in the Ae. albopictus library and 107,190 reads in the Cx. quinquefasciatus library. In fact, miR-184 dominated the Ae. albopictus library, accounting for >95% of all miRNA reads. To date, miR-184 has been identified in over 39 organisms, but has no defined role in insects. Surprisingly, although small RNAs were prepared from blood-fed whole Cx. quinquefasciatus mosquitoes compared to Ae. albopictus C710 cells, these two species shared five out of the top ten most frequently occurring miRNAs: miR-184, miR-317, miR-277, miR-275, and miR-8 (Tables 1, 2). In Drosophila, miR-277 has predicted targets in metabolic pathways [20] while miR-8 plays a role in Wnt signaling [36]. miR-275 and miR-317 have no experimentally reported targets to date.

            Mature miRNA species showed sequence lengths between 19 and 24 nt with a predominance of 22 nt and also exhibited strong bias for a 5' uracil (> 65% of all identified miRNAs) (Tables 1, 2). The presence of a 5' U is a characteristic of many miRNAs [37, 38], at least in part, because strand selection of the miRNA from the miRNA:miRNA* duplex is based on the level of thermodynamic stability of the paired ends of the duplex [27, 39, 40].

            Mosquito miRNAs are highly conserved

            The Ae. albopictus genome is not yet sequenced. Since miRNA sequences are highly conserved between species, we mapped miRNAs cloned from the Ae. albopictus cell line to the Ae. aegypti genome. Interestingly, all Ae. albopictus miRNAs and miRNA* strands mapped with 100% identity to the Ae. aegypti genome, indicating evolutionary constraints on not only the mature miRNA sequences, but also the pre-miRNA hairpins. 72 of the 74 Culex miRNA sequences mapped with 100% identity to the Cx. quinquefasciatus genome [35]. The identified sequence for miR-309 (Table 2) differed by one nucleotide (nt 11) from the Cx. quinquefasciatus genomic sequence. miR-927, occurring 700 times in the Cx. quinquefasciatus library (Table 2), exhibited sequence differences at nucleotides 1 and 16 compared to the Cx. quinquefasciatus genome. When mapped to the Ae. aegypti genome, one nucleotide differed from the genomic sequence. These sequence variations could not be accounted for by miRNA editing.

            Several miRNA sequences mapped to multiple locations in the Cx. quinquefasciatus and Ae. aegypti genomes. Six Cx. quinquefasciatus miRNAs, miR-317, miR-252, miR-276, miR-190, miR-981, and miR-2944, arise from at least two possible hairpin precursors (Table 2). In Aedes, four miRNAs, miR-276, miR-317, miR-1000, and miR-309 arise from two potential hairpin precursors (Table 1).

            With the exception of miR-33, all Ae. albopictus miRNAs were also identified in Cx. quinquefasciatus mosquitoes. Additionally, 14 miRNAs present in Cx. quinquefasciatus mosquitoes, but absent from Ae. albopictus cells, mapped with 100% sequence identity to the Ae. aegypti genome, and are annotated as predicted (Tables 1 and 2). Of note, Cx. quinquefasciatus miR-1174 was not found in Ae. aegypti; however, the annotated mature miRNA sequence for An. gambiae miR-1174 aligns to the Ae. aegypti genome with 95% sequence identity. Table 1 contains the predicted miR-1174 sequence for Ae. aegypti. Interestingly, Cx. quinquefasciatus miR-1174 is orthologous not to the mature miR-1174 in An. gambiae, but to the predicted miR-1174* (19 out of 22 nt); only these 19 nucleotides are conserved between the Cx. quinquefasciatus and An. gambiae pre-miRNAs. In total, 75 Aedes and Cx. quinquefasciatus conserved miRNAs were identified, representing over 55 seed families (Tables 1, 2).

            64 of the 75 miRNAs identified in Cx. quinquefasciatus and Ae. albopictus have orthologs in D. melanogaster. In addition to D. melanogaster, we examined orthologous miRNA sequences from two other winged insects, An. gambiae and Apis mellifera (Tables 1, 2). Five miRNAs, miR-1175, miR-1174, miR-1889, miR-1890, and miR-1891, have previously been identified in Anopheles mosquitoes but, to date, lack orthologs in D. melanogaster or A. mellifera. Interestingly, for miR-1890, only the miRNA sequenced is conserved between Anopheles, Culex, and Aedes, and extensive sequence variations occur in the remaining arm and loop of the precursor. While this manuscript was under review, eight additional novel mosquito-specific miRNAs were identified in Ae. aegypti mosquitoes [41]. miR-2944a/b is present at low levels in Cx. quinquefasciatus; miR-2943 and miR-2945 are present at low levels in both Cx. quinquefasciatus mosquitoes and C710 cells (Tables 1 and 2). While orthologs of these mosquito-specific miRNAs may be identified in other organisms in the future, this group of miRNAs appears to be restricted to mosquitoes and hence, may be of more recent evolutionary origin.

            Sequence variation occurs predominantly at the 3' end of mature miRNAs

            In each small RNA library, reads aligning to a given mature miRNA showed some degree of variability. Most variability occurred at the 3'ends of each mature miRNA, when compared to the 5' ends. Figure 2A depicts this variance for all conserved miRNAs present in the Culex library. Each canonical miRNA sequence is set at "0"; nucleotide truncations from either the 3' or 5' end are shown by negative numbers, whilst nucleotide additions are shown by positive numbers. 20.5% of miRNA reads exhibited 3' end variability compared to only 0.8% of reads for 5' variability. In accordance with other miRNA studies [18, 42, 43], we found that the majority of miRNAs, such as miR-1 (Figure 2B), followed this pattern of 5' sequence homogeneity and 3' heterogeneity. Precision at the mature miRNA 5' end has been reported for Drosophila miRNAs [44]. Such observations are congruent with the idea that the seed sequence, located within the 5' end of the miRNA, is evolutionarily constrained [15, 29].
            http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-11-119/MediaObjects/12864_2009_Article_2713_Fig2_HTML.jpg
            Figure 2

            Culex miRNA sequence variations. A) The total number of canonical miRNA sequence reads, annotated in Table 2, is set to "0" on the x-axis. Differences in the total numbers of canonical 3' versus 5' miRNA ends are due to greater diversity at the 3' end of a given miRNA. Negative numbers on the x-axis indicate 3' or 5' nucleotide truncations in a miRNA sequence, while positive numbers indicate 3' or 5' nucleotide additions. 58 Culex miRNAs (sequenced at least 10 times) are collectively represented. The numbers of reads with 3' or 5' nucleotide truncations or additions for individual miRNAs, B) miR-1, C) miR-210, and D) miR-252 are shown.

            At least two miRNAs, however, did not match this trend. For both miR-210 and miR-252, two dominant miRNA species were identified (Figure 2C and 2D; Tables 1, 2). For miR-210, the most frequently occurring species was sequenced 301 times, while the second dominant species, one nucleotide longer with a cytosine at the 5' end, was sequenced 274 times. Due to variations in the 5' and 3' ends for the remaining 550 reads aligning to miR-210, the canonical 5' and 3' ends were actually represented by the second most frequently occurring sequence, which is annotated (Table 2). Interestingly, two dominant forms of miR-210, miR-210.1 and miR-210.2, one of which contains an extra 5' nucleotide, have been noted for D. melanogaster [18]. Furthermore, of the 19 reads aligning to miR-210 in the Ae. albopictus library, 13 (68%) contain an extra 5' cytosine. Only one copy of the miR-210 precursor is present in these insect genomes, therefore such differences cannot be attributed to processing from multiple pri-miRNAs. Mosquitoes and fruit flies diverged over 250 million years ago. Thus, it is striking that we see these same two forms of miR-210 expressed in mosquitoes. Our data provide strong evidence in support of the hypothesis that these two forms of miR-210 are evolutionarily conserved and are likely to function as at least partly distinct miRNAs in vivo.

            miR-252, which maps to two loci within the Cx. quinquefasciatus genome, but only one locus in each of the Ae. aegypti and An. gambiae genomes, also exhibited similar variation at the 5' end (Figure 2D). The dominant, canonical miRNA species was sequenced 1,688 times, while the second dominant species, with a 5' cytosine addition, was sequenced 719 times. We also observed miR-252 variations in the Ae. albopictus library. 35% of the 2496 sequences aligning to Ae. albopictus miR-252 contained one extra 5' cytosine. The two 69 nt pri-miRNA stem-loops for Cx. quinquefasciatus miR-252 are 100% identical, and show 100% and 97% sequence identity with miR-252 pri-miRNA stem-loops present in the Ae. aegypti and An. gambiae genomes, respectively. Thus, these variations in the mature miRNA sequences, for both miR-252 and miR-210, do not appear to arise from differences in hairpin folding properties, and likely are a result of Drosha and/or Dicer processing.

            The consequences of 5' variation can be severe, since an alteration to the 5' seed creates a new group of potential target mRNAs for a miRNA [29]. Depending on the length of the complementary seed match within a target mRNA, miRNAs arising from a single precursor, yet exhibiting 5' variation, could have both overlapping and distinct targets.

            Whereas some miRNAs exhibited sequence differences at the 5' or 3' ends, we also noted differences in the ratios of miRNA:miRNA* reads when examining the Cx. quinquefasciatus and Ae. albopictus libraries. miRNA* strands for several miRNAs, including miR-8, miR-1889, and bantam, were sequenced a significant number of times, and thus are annotated with 5p or 3p (Tables 1, 2). In C7/10 cells, miR-1889-3p and miR-1889-5p were expressed at nearly identical levels, suggesting that both strands of the miRNA:miRNA* duplex are loaded equally into RISC as mature miRNAs. Interestingly, for miR-8 in the Ae. albopictus library, the ratio of 5p:3p miRNA reads was 1,244 miR-8-5p: 3,002 miR-8-3p (ratio of 0.41) (Table 1). In Cx. quinquefasciatus mosquitoes, however, the ratio was much different. miR-8-5p occurred only 594 times compared to miR-8-3p which occurred 10,950 times (ratio of 0.05) (Table 2). Of note, the dominant miRNA species for Ae. albopictus miR-8-3p contains one less 3' nucleotide compared to Cx. quinquefasciatus miR-8-3p.

            We investigated the predicted miR-8 pre-miRNA structures in Ae. aegypti, Cx. quinquefasciatus, and An. gambiae. Ae.aegypti miR-8 pre-miRNA shares 98% and 92% sequence identity with the miR-8 pre-miRNA in Cx. quinquefasciatus and An. gambiae, respectively. Intriguingly, all nucleotide differences for miR-8 affect only the terminal loop of the pre-miRNA hairpin, which alters the pairing at the immediate base of the terminal loop. Thus, differences in the miRNA-5p:miRNA-3p ratios may reflect the RNA folding properties of the pre-miRNA within each species, which is known to influence strand selection. Furthermore, nucleotide diversity in the terminal loop for miR-8, a miRNA known to be involved in Wnt signaling in the fly [21, 36], may help fine tune not only miRNA strand selection but also the miRNA sequence itself, thereby also fine tuning miRNA target regulation.

            Whilst the total number of miRNA* strands accounted for a low percentage (<0.3%) of mapped reads in each small RNA library, some miRNA* strands were sequenced more frequently than individual miRNA species. For example, in total RNA from C7/10 cells, bantam-3p was sequenced 475 times, and therefore accounts for a greater percentage of the small RNA population than those mature miRNAs sequenced less than 400 times. Likewise, miR-281* in Cx. quinquefasciatus mosquitoes was sequenced 95 times, and thus accounts for a greater percentage of small RNAs than those occurring less than 95 times. Importantly, the biological relevance of the miRNA* population has been demonstrated in Drosophila; miRNA* strands can be loaded into Ago1-containing RISC and target complementary 3' UTRs of mRNAs [45].

            Confirmation of mosquito miRNAs

            We used primer extension analysis to confirm the expression of several of the miRNAs represented in our sequencing data. Five miRNAs, miR-184, miR-275, miR-277, miR-276, and miR-92, were sequenced >500 times and were readily detectable in total RNA isolated from C7/10 cells (Figure 3A). Five miRNAs, miR-1, miR-317, miR-277, miR-989, and miR-92 were sequenced >120 times and were readily detectable in total RNA isolated from Cx. quinquefasciatus mosquitoes (Figure 3B). In general, the detection level of a given miRNA reflected the overall abundance of that miRNA in the sequenced library (Figure 3, Tables 1, 2). All miRNAs analyzed by this method exhibited the expected sizes.
            http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-11-119/MediaObjects/12864_2009_Article_2713_Fig3_HTML.jpg
            Figure 3

            Primer extension analysis confirms miRNA expression. Total RNA was isolated from A) C7/10 cells or C7/10-WNV312 cells persistently infected with WNV replicons and B, C) Cx. quinquefasciatus mosquitoes fed a non-infectious blood meal (Culex) or a blood meal containing WNV-NY99 (Culex- WNV). 10 μg (A, C) or 4 μg (B) of RNA was used for primer extension to detect miRNAs. For each miRNA, free probe with no RNA is shown as a negative control. Ethidum bromide stained rRNA is shown as loading control.

            Identification of novel mosquito miRNAs

            To identify novel mosquito miRNAs, we used a combination of miRDeep [46] and MFold [47] to ask whether non-annotated sequences mapping to the mosquito genomes demonstrated folding properties of pre-miRNA hairpins. Each novel miRNA follows both expression and biogenesis criteria set forth for identifying new miRNAs, which include (i) a small RNA of appropriate and discrete length (19-24 nt), (ii) arising from one arm of a hairpin precursor, (iii) presence of the star strand, and (iv) evolutionary conservation [13, 18, 48].

            Four new Aedes miRNAs (five hairpins) and three new Cx. quinquefasciatus miRNAs (four hairpins) were identified (Tables 1, 2). Each miRNA arises from RNA structures which fold into canonical pre-miRNA hairpins (Figures 4 and 5). Four of the new miRNAs reside on the 5p arms of their respective precursors (Figure 4B and 4C), while the remaining three miRNAs reside on the 3p arms (Figure 5). Primer extension analysis confirmed the expression of five of these miRNAs (Figures 4 and 5).
            http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-11-119/MediaObjects/12864_2009_Article_2713_Fig4_HTML.jpg
            Figure 4

            Identification of novel mosquito miRNAs. Primer extension analysis was used to confirm the expression of A) three novel Ae. albopictus miRNAs and C) one novel Cx. quinquefasciatus miRNAs. Total RNA was isolated from C7/10 cells or Cx. quinquefasciatus mosquitoes as described in Figure 3 and Methods. B) and D) Predicted pre-miRNA stem-loop structures for each novel miRNA. Ae. albopictus miRNAs were mapped to the Ae. aegypti genome, and therefore may not reflect the actual pre-miRNA structures. Mature miRNA sequences are shown in red, while corresponding miRNA* sequences identified in each library are shown in blue. For miR-2951, asterisks indicate additional 5' nucleotides present in a lower percentage of the reads mapping to each miRNA compared to the canonical sequence annotated in Tables 1 and 2. Ae. albopictus miR-2951 differs by one nucleotide from the Ae. aegypti genome. E) Pre-miRNA structures for two novel orthologous miRNAs mapping to the A. gambiae genome. The predicted mature miRNAs, based on sequence conservation, are shown in red.

            http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-11-119/MediaObjects/12864_2009_Article_2713_Fig5_HTML.jpg
            Figure 5

            Novel mosquito miRNAs are clustered. A) Predicted pre-miRNA stem-loop structures for cqu-miR-2941-1, cqu-miR-2941-2, and cqu-miR-2952. B) Primer extension analysis confirms miR-2941 expression in total RNA isolated from Cx. quinquefasciatus adult female blood-fed mosquitoes (see Methods). C) Predicted pre-miRNA stem-loop structures for aae-miR-2941-1, and aae-miR-2941-2. As in Figure 4, mature miRNAs are shown in red, and miRNA* strands, when identified in a library, are shown in blue. D) Genomic location of the miR-2941 clusters in the Cx. quinquefasciatus and Ae. aegypti genomes. Numbers on the bottom indicate the nucleotide distance between pri-miRNA stem-loops for each miRNA.

            miR-2940, which lacks seed homology to any known miRNA, was amongst the most frequently recovered miRNAs present in the Ae. albopictus library, sequenced 125,253 times; miR-2940* was sequenced 4,125 times (Table 1). Interestingly, miR-2940 and miR-2940* are separated by 60 nt of intervening sequence, resulting in a 104 nt pre-miRNA (Figure 4B). This pre-miRNA length is unusual for metazoan pre-miRNAs, which are normally ~60 nt in length [24]. Plant pre-miRNAs, however, can be as long as 200 nt [13], and several Drosophila miRNAs arise from long hairpins >100 nt. The D. melanogaster miR-989 precursor, for example, has 99 nt of intervening sequence between the miRNA and miRNA* [18].

            Two novel Aedes miRNAs, miR-2765 and miR-2951, arise from pre-miRNAs with typical lengths of 59 nt and 57 nt, respectively (Figure 4B). Both miRNAs were sequenced ~1,100 times; however, primer extension analysis suggested that miR-2951 is expressed at higher levels than miR-2765 (Figure 4A). Like miR-2940, miR-2765 shows no seed sequence homology to any known miRNA present in miRBase v14. miR-2951 is 100% identical to cqu-miR-2951, expressed in Culex mosquitoes (Figure 4C).

            Whilst the majority of new miRNAs exhibited discrete lengths, as determined from both sequencing data and primer extension analysis (Figure 4 and 5), we observed variations in the 5'ends of both Ae. albopictus miR-2951 and Cx. quinquefasciatus miR-2951, which affect the seed. 29% of Ae. albopictus miR-2951 reads contained an additional 5' G, while Cx. quinquefasciatus miR-2951 reads contained 5' GG (3.4%) or 5' G (30.2%) additions or single nucleotide 5' truncations (12%) compared to the canonical sequence (54.4% of reads). Furthermore, unlike Aedes miR-2951*, for which a distinct sequence was identified, over five equally abundant sequences for Cx. quinquefasciatus miR-2951* were observed, which affect the positioning of the star strand in the pre-miRNA hairpin (Table 1, 2). Only 15 nucleotides, excluding the potential 5' seed, are conserved between Aedes miR-2951*, and Cx. quinquefasciatus miR-2951*, contributing to differences in the predicted pre-miRNA hairpin structures. These differences are also due, in part, to nucleotide differences in the terminal loops (Figure 4B and 4D). These sequence variations might also be attributed to diversity in the flanking pri-miRNA sequences; miR-2951 maps to eight locations within each of the Ae. aegypti and Cx. quinquefasciatus genomes. Notably, within each genome, all pre-miRNA loci share 100% sequence identity.

            We queried three mosquito genomes (Cx. quinquefasciatus, An. gambiae, Ae. aegypti) present in VectorBase for the presence of each new miRNA. Both miR-2940 and miR-2765 have orthologs in An. gambiae (Figure 4E). The predicted precursor for miR-2765 is 93% identical at the sequence level in An. gambiae, while the mature miRNA sequence is 100% conserved. Interestingly, for miR-2940, the orthologous sequence mapping to An. gambiae chromosome X with 95% sequence identity was actually miR-2940*. Given that miR-2940* was sequenced over 4,000 times, it is possible that both strands of the miR-2940:miR-2940* duplex are loaded into RISC and function as mature miRNAs. Notably, the predicted 5p arm for An. gambiae miR-2940 exhibits the same seed sequence as miR-2940-5p from Aedes, suggesting similar functions in mRNA targeting (Figure 4B and 4E). No orthologs for miR-2951 or miR-2952 were found in An. gambiae. In fact, miR-2952 appears to be specific to Cx. quinquefasciatus.

            Two additional miRNAs, aae-miR-2941 and cqu-miR-2941, are also orthologs conserved in Aedes and Cx. quinquefasciatus. cqu-miR-2941 was readily detectable by primer extension analysis in Cx. quinquefasciatus (Figure 5B); however, miR-2941 was sequenced only nine times in the Ae. albopictus library, and thus was below the limit of detection. aae-miR-2941 and cqu-miR-2941 each arise from two different pre-miRNA hairpins that map to two loci (Figure 5A and 5C). cqu-miR-2941* strands from both of the Cx. quinquefasciatus pre-miRNAs were identified (Table 2), indicating that both hairpins are expressed and processed. The pre-miRNAs for both aae-miR-2941 and cqu-miR-2941 are clustered within a ~350 nt stretch which, for Cx. quinquefasciatus, also includes another novel miRNA, miR-2952 (Figure 5D). Notably, miR-2941 and miR-2952 share the first nine 5' nucleotides and thus, have the same seed (Table 2), suggesting these two miRNAs might regulate an overlapping set of target mRNAs.

            Clusters of mosquito miRNA genes

            The miR-2941 cluster represents a novel miRNA cluster present in both Cx. quinquefasciatus and Aedes mosquito genomes. To determine whether additional conserved miRNAs were clustered, we considered miRNAs which mapped to locations within 1 kb of each other. Nine mosquito miRNAs followed this pattern (Table 1, 2). The ordered distribution of each of the nine pre-miRNAs in the Ae. aegypti genome was similar to the distribution of pre-miRNAs in the Cx. quinquefasciatus genome, with two exceptions. miR-11 and miR-989 map to the plus strand in the Ae. aegypti genome, but map to the minus strand in Cx. quinquefasciatus. It is possible that this cluster is inverted in Cx. quinquefasciatus since (i) miR-11 and miR-989 are located on the plus strand in An. gambiae [35] and (ii) the order of miRNAs is still conserved. Based on sequencing reads, miRNAs within each cluster did not appear to be evenly expressed (Tables 1, 2).

            Culex miR-989 and miR-92 expression levels are altered during flavivirus infection

            miRNAs are known to be important regulators of development. Additionally, miRNA expression profiles can be altered in response to environmental changes such as stress or infection. Four An. gambiae miRNAs, miR-34, miR-1174, miR-1175, and miR-989, show changes in expression during Plasmodium infection [11]. Given that Cx. quinquefasciatus and Ae. albopictus are important flavivirus vectors, we asked whether any miRNAs were aberrantly expressed during infection with WNV.

            We assayed miRNA expression in WNV-replicon C7/10 cells and WNV-NY99 infected Cx. quinquefasciatus using primer extension. Persistent infection of C7/10 cells with WNV-replicons had no significant effect on the expression levels of the miRNAs assayed (Figures 3A and 4A). A comparison of blood-fed, uninfected female Cx. quinquefasciatus mosquitoes to age- and sex-matched WNV-NY99 infected mosquitoes revealed that the majority of miRNAs were unaffected; however, we observed 2.8 fold downregulation of miR-989 following WNV-NY99 infection (Figure 3B; Additional file 1, Figure S1). In contrast, miR-92 expression was upregulated in WNV-infected Cx. quinquefasciatus (Figure 3C; Additional file 1, Figure S1). Notably, this pattern of miRNA expression for miR-989 and miR-92 is also found in deep sequencing reads of WNV-infected Cx. quinquefasciatus (Additional file 2, Table S1). We also observed changes in miR-957, miR-970, miR-980, and miR-33, among others (Additional file 2, Table S1).

            The targets of miR-989 and miR-92 in mosquitoes are not yet known; however, several studies have examined expression of these miRNAs during development. In An. gambiae, An. stephensi, and Ae. aegypti, miR-989 expression is restricted to female mosquitoes and found predominantly in the ovaries [10, 11]. While this manuscript was in review, Li et.al. reported 454 deep sequencing of miRNAs in Ae. aegypti mosquitoes; miR-989 is also present in the midgut while miR-92 is present in Ae. aegypti embryos [41]. In the silkworm Bombyx mori, miR-92 is associated with embryogenesis, a stage of high cellular proliferation and differentiation [49]. Furthermore, in vertebrates, miR-92 is a member of the conserved miR-17-92 cluster and is associated with oncogenesis and increased cellular proliferation. Given the dysregulation of miR-989 and miR-92 during WNV infection, it is interesting to speculate that the targets of these miRNAs may play roles in mediating flavivirus infection in the mosquito host.

            Conclusions

            This study provides experimental evidence for over 65 conserved and seven novel miRNAs present in Aedes and Cx. quinquefasciatus mosquitoes, and increases our current understanding of insect miRNAs. The majority of miRNAs identified here demonstrate conventional miRNA characteristics including evolutionary conservation, 5' end homogeneity, and an ~60 nt pre-miRNA. A small number of miRNAs were found that deviate from these standards. Cx. quinquefasciatus and Aedes miR-210, miR-252, and miR-2951 are examples of multiple, distinct miRNAs arising from one arm of a single hairpin (Figures 2 and 4). Aedes miR-2940, among others, arises from an unusually long pre-miRNA (Figure 4A). Additionally, the prevalence of the miRNA* strand for several miRNAs, such as miR-1889, miR-8, and bantam, expands the potential of miRNA regulation in an organism by adding to the number of possible miRNA seeds and thus adding new mRNA targets. Finally, of the novel miRNAs identified here, four currently lack orthologs in non-mosquito species, bringing the total mosquito-specific miRNAs to 16 [41].

            Aedes and Culex mosquitoes are major arbovirus vectors, important in transmitting both alphaviruses and flaviviruses to humans. We found miR-989, a female-specific miRNA in Anopheles and Aedes mosquitoes, to be downregulated in WNV-infected Cx. quinquefasciatus while miR-92 is significantly upregulated. This is the first report of miRNA dysregulation following flavivirus infection of a natural mosquito host. Future research will elucidate the functions of these newly identified miRNAs in mosquito biology. Undoubtedly, some of the miRNAs identified here will have roles not only in mosquito development, like their Drosophila counterparts, but also in mediating viral infection in the mosquito host.

            Methods

            Mosquitoes and Cell Lines

            Cx. quinquefasciatus mosquitoes (Sebring strain) were reared and maintained as previously described [50]. Female mosquitoes were fed a non-infectious blood meal containing 2 mL of Vero cells and media mixed with 2 mL of defibrinated sheep blood (Colorado Serum Company, Denver, CO) or an infectious blood meal containing 2 mL of WNV NY99 [51] infected Vero cells with media and 2 mL of sheep blood. The meals were presented separately to 200 female mosquitoes 3 to 5 day post-eclosion as previously described [50]. Mosquitoes were instantaneously killed in Eppendorf tubes by submersion in a dry ice/liquid nitrogen bath at 14 days post-blood meal and stored in RNAlater prior to RNA extraction. Ae. albopictus C7/10 cells were maintained at 28°C in Leibowitz L-15 media supplemented with 10% FCS, 10% tryptose phosphate broth, and antibiotics. C7/10-WNV replicon cells were generated by infecting C7/10 cells with GFP-expressing WNV replicon particles [52, 53]. The cells were sorted for GFP expression 7 days post-infection, and monitored for GFP expression for one month prior to analysis to verify establishment of a persistent infection. Infection of both mosquitoes and C7/10 cells was confirmed by qRT-PCR [52].

            RNA extraction and Primer Extensions

            Total RNA was prepared from ~100 whole mosquitoes and two 80% confluent T75 flasks of Ae. albopictus cells using TRIzol (Invitrogen) according to the manufacturer's protocol. Primer extensions were performed with 4 μg (Cx. quinquefasciatus) or 10 μg (C7/10) of total RNA using the AMV PE kit according to manufacturer's protocol (Promega). Oligonucleotides used for probes are listed (Additional file 3, Table S2) and were end-labeled using gamma-[32P]-ATP and T4 polynucleotide kinase. To detect individual miRNAs, a master mix was prepared for each probe and divided equally amongst the reactions. Reverse transcription products were separated on 15% TBE-urea polyacrylamide gels, exposed to film, and subjected to analysis using NIH ImageJ (Additional file 1, Figure S1).

            Small RNA cloning

            Thirty micrograms of total RNA were size-fractionated on a 15% TBE-Urea polyacrylamide gel. Small RNA populations corresponding to 18-28 nt in size were extracted, eluted, and ligated to a 3' linker using T4 RNA ligase (Epicentre). 3' ligation reactions were loaded directly onto a 10% TBE-Urea polyacrylamide gel, and ligation products recovered by high-salt elution following electrophoresis. Next, a 5' linker was ligated, and products were used for SSII reverse transcription (Invitrogen). PCR reactions were carried out using the RT primer and 5' PCR primer. Linker and primer sequences are provided in Additional file 3, Table S2. Amplified cDNA products were gel-purified prior to submission for sequencing. High-throughput sequencing was performed by the Duke IGSP Sequencing Core Facility on an Illumina Genome Analyzer II.

            Bioinformatics

            Sequencing reads were parsed using in-house scripts according to the following criteria: a 5' and 3' linker match of at least 4 nt and an appropriate length (18-28 nt).

            To find miRNA orthologs, sequences were mapped to known miRNAs, miRNA star strands, and hairpins present in miRBase v14.0 http://​microrna.​sanger.​ac.​uk using NCBI BLAST (word size = 17, p = 85, D = 2) allowing for a 2 nt mismatch, and parsed further using Perl scripts from the miRDeep pipeline [46]. Mosquito genomes (Cx. quinquefasciatus Johannesburg strain and Ae. aegypti Liverpool strain) were obtained from http://​vectorbase.​org and coordinates for miRNA sequences were extracted using BLAST. For new miRNA discovery, reads mapping to each mosquito genome were analyzed using the miRDeep pipeline [46]. To further confirm novel miRNAs, reads of 19-24 nt in length occurring at least 100 times in a library were mapped to mosquito genomes, and sequences of 200 nt in length surrounding the putative miRNA were extracted, and folded using MFold [47]. FASTA files containing all unique reads for the C7/10 and Culex libraries as well as miRNA precursor sequences are provided (Additional files 4 5 6 7).

            Declarations

            Acknowledgements

            This work was supported by NIH grant U54-AI-057157 from the Southeastern Regional Center of Excellence for Emerging Infections and Biodefense to BRC, and by funds provided by the UTMB Department of Pathology to SH. DLV was supported by an NIH T32 grant (A107536). We thank Tonya Severson of the Duke Institute for Genome Sciences and Policy Core Sequencing Facility for assistance with high-throughput sequencing. We gratefully acknowledge the technical assistance of Jing H. Huang for the rearing of the Cx. p. quinquefasciatus mosquitoes.

            Authors’ Affiliations

            (1)
            Department of Molecular Genetics and Microbiology and Center for Virology, Duke University Medical Center
            (2)
            Department of Microbiology, North Carolina State University
            (3)
            Department of Pathology and Department of Microbiology and Immunology, University of Texas Medical Branch

            References

            1. Gould EA, Solomon T: Pathogenic flaviviruses. Lancet 2008, 371: 500–509.PubMedView Article
            2. Mackenzie JS, Gubler DJ, Petersen LR: Emerging flaviviruses: the spread and resurgence of Japanese encephalitis, West Nile and dengue viruses. Nat Med 2004, 10: S98–109.PubMedView Article
            3. Gratz NG: Critical review of the vector status of Aedes albopictus. Med Vet Entomol 2004, 18: 215–227.PubMedView Article
            4. Ebel GD, Rochlin I, Longacker J, Kramer LD: Culex restuans (Diptera: Culicidae) relative abundance and vector competence for West Nile Virus. J Med Entomol 2005, 42: 838–843.PubMedView Article
            5. Girard YA, Klingler KA, Higgs S: West Nile virus dissemination and tissue tropisms in orally infected Culex pipiens quinquefasciatus. Vector Borne Zoonotic Dis 2004, 4: 109–122.PubMedView Article
            6. Girard YA, Popov V, Wen J, Han V, Higgs S: Ultrastructural study of West Nile virus pathogenesis in Culex pipiens quinquefasciatus (Diptera: Culicidae). J Med Entomol 2005, 42: 429–444.PubMedView Article
            7. Renault P, Solet JL, Sissoko D, Balleydier E, Larrieu S, Filleul L, Lassalle C, Thiria J, Rachou E, de Valk H, et al.: A major epidemic of chikungunya virus infection on Reunion Island, France, 2005–2006. Am J Trop Med Hyg 2007, 77: 727–731.PubMed
            8. Vazeille M, Moutailler S, Coudrier D, Rousseaux C, Khun H, Huerre M, Thiria J, Dehecq JS, Fontenille D, Schuffenecker I, et al.: Two Chikungunya isolates from the outbreak of La Reunion (Indian Ocean) exhibit different patterns of infection in the mosquito, Aedes albopictus. PLoS One 2007, 2: e1168.PubMedView Article
            9. Griffiths-Jones S: miRBase: the microRNA sequence database. Methods Mol Biol 2006, 342: 129–138.PubMed
            10. Mead EA, Tu Z: Cloning, characterization, and expression of microRNAs from the Asian malaria mosquito, Anopheles stephensi. BMC Genomics 2008, 9: 244.PubMedView Article
            11. Winter F, Edaye S, Huttenhofer A, Brunel C: Anopheles gambiae miRNAs as actors of defence reaction against Plasmodium invasion. Nucleic Acids Res 2007, 35: 6953–6962.PubMedView Article
            12. Lai EC, Tomancak P, Williams RW, Rubin GM: Computational identification of Drosophila microRNA genes. Genome Biol 2003, 4: R42.PubMedView Article
            13. Bartel DP: MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 2004, 116: 281–297.PubMedView Article
            14. Ambros V: MicroRNA pathways in flies and worms: growth, death, fat, stress, and timing. Cell 2003, 113: 673–676.PubMedView Article
            15. Bartel DP: MicroRNAs: target recognition and regulatory functions. Cell 2009, 136: 215–233.PubMedView Article
            16. Farh KK, Grimson A, Jan C, Lewis BP, Johnston WK, Lim LP, Burge CB, Bartel DP: The widespread impact of mammalian MicroRNAs on mRNA repression and evolution. Science 2005, 310: 1817–1821.PubMedView Article
            17. Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T: Identification of novel genes coding for small expressed RNAs. Science 2001, 294: 853–858.PubMedView Article
            18. Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC: Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs. Genome Res 2007, 17: 1850–1864.PubMedView Article
            19. Ambros V: The functions of animal microRNAs. Nature 2004, 431: 350–355.PubMedView Article
            20. Stark A, Brennecke J, Russell RB, Cohen SM: Identification of Drosophila MicroRNA targets. PLoS Biol 2003, 1: E60.PubMedView Article
            21. Brennecke J, Hipfner DR, Stark A, Russell RB, Cohen SM: bantam encodes a developmentally regulated microRNA that controls cell proliferation and regulates the proapoptotic gene hid in Drosophila. Cell 2003, 113: 25–36.PubMedView Article
            22. Leaman D, Chen PY, Fak J, Yalcin A, Pearce M, Unnerstall U, Marks DS, Sander C, Tuschl T, Gaul U: Antisense-mediated depletion reveals essential and specific functions of microRNAs in Drosophila development. Cell 2005, 121: 1097–1108.PubMedView Article
            23. Kim VN: MicroRNA biogenesis: coordinated cropping and dicing. Nat Rev Mol Cell Biol 2005, 6: 376–385.PubMedView Article
            24. Cullen BR: Transcription and processing of human microRNA precursors. Mol Cell 2004, 16: 861–865.PubMedView Article
            25. Denli AM, Tops BB, Plasterk RH, Ketting RF, Hannon GJ: Processing of primary microRNAs by the Microprocessor complex. Nature 2004, 432: 231–235.PubMedView Article
            26. Forstemann K, Horwich MD, Wee L, Tomari Y, Zamore PD: Drosophila microRNAs are sorted into functionally distinct argonaute complexes after production by dicer-1. Cell 2007, 130: 287–297.PubMedView Article
            27. Tomari Y, Du T, Zamore PD: Sorting of Drosophila small silencing RNAs. Cell 2007, 130: 299–308.PubMedView Article
            28. Campbell CL, Black WCt, Hess AM, Foy BD: Comparative genomics of small RNA regulatory pathway components in vector mosquitoes. BMC Genomics 2008, 9: 425.PubMedView Article
            29. Lewis BP, Burge CB, Bartel DP: Conserved seed pairing, often flanked by adenosines, indicates that thousands of human genes are microRNA targets. Cell 2005, 120: 15–20.PubMedView Article
            30. Brennecke J, Stark A, Russell RB, Cohen SM: Principles of microRNA-target recognition. PLoS Biol 2005, 3: e85.PubMedView Article
            31. Lewis BP, Shih IH, Jones-Rhoades MW, Bartel DP, Burge CB: Prediction of mammalian microRNA targets. Cell 2003, 115: 787–798.PubMedView Article
            32. Krek A, Grun D, Poy MN, Wolf R, Rosenberg L, Epstein EJ, MacMenamin P, da Piedade I, Gunsalus KC, Stoffel M, Rajewsky N: Combinatorial microRNA target predictions. Nat Genet 2005, 37: 495–500.PubMedView Article
            33. Friedman RC, Farh KK, Burge CB, Bartel DP: Most mammalian mRNAs are conserved targets of microRNAs. Genome Res 2009, 19: 92–105.PubMedView Article
            34. Umbach JL, Cullen BR: The role of RNAi and microRNAs in animal virus replication and antiviral immunity. Genes Dev 2009, 23: 1151–1164.PubMedView Article
            35. Lawson D, Arensburger P, Atkinson P, Besansky NJ, Bruggner RV, Butler R, Campbell KS, Christophides GK, Christley S, Dialynas E, et al.: VectorBase: a data resource for invertebrate vector genomics. Nucleic Acids Res 2009, 37: D583–587.PubMedView Article
            36. Kennell JA, Gerin I, MacDougald OA, Cadigan KM: The microRNA miR-8 is a conserved negative regulator of Wnt signaling. Proc Natl Acad Sci USA 2008, 105: 15417–15422.PubMedView Article
            37. Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP: Vertebrate microRNA genes. Science 2003, 299: 1540.PubMedView Article
            38. Du T, Zamore PD: microPrimer: the biogenesis and function of microRNA. Development 2005, 132: 4645–4652.PubMedView Article
            39. Schwarz DS, Hutvagner G, Du T, Xu Z, Aronin N, Zamore PD: Asymmetry in the assembly of the RNAi enzyme complex. Cell 2003, 115: 199–208.PubMedView Article
            40. Khvorova A, Reynolds A, Jayasena SD: Functional siRNAs and miRNAs exhibit strand bias. Cell 2003, 115: 209–216.PubMedView Article
            41. Li S, Mead EA, Liang S, Tu Z: Direct sequencing and expression analysis of a large number of miRNAs in Aedes aegypti and a multi-species survey of novel mosquito miRNAs. BMC Genomics 2009, 10: 581.PubMedView Article
            42. Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP: The microRNAs of Caenorhabditis elegans. Genes Dev 2003, 17: 991–1008.PubMedView Article
            43. Lau NC, Lim LP, Weinstein EG, Bartel DP: An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans. Science 2001, 294: 858–862.PubMedView Article
            44. Seitz H, Ghildiyal M, Zamore PD: Argonaute loading improves the 5' precision of both MicroRNAs and their miRNA strands in flies. Curr Biol 2008, 18: 147–151.PubMedView Article
            45. Okamura K, Phillips MD, Tyler DM, Duan H, Chou YT, Lai EC: The regulatory activity of microRNA* species has substantial influence on microRNA and 3' UTR evolution. Nat Struct Mol Biol 2008, 15: 354–363.PubMedView Article
            46. Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N: Discovering microRNAs from deep sequencing data using miRDeep. Nat Biotechnol 2008, 26: 407–415.PubMedView Article
            47. Zuker M: Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res 2003, 31: 3406–3415.PubMedView Article
            48. Ambros V, Bartel B, Bartel DP, Burge CB, Carrington JC, Chen X, Dreyfuss G, Eddy SR, Griffiths-Jones S, Marshall M, et al.: A uniform system for microRNA annotation. RNA 2003, 9: 277–279.PubMedView Article
            49. Liu S, Zhang L, Li Q, Zhao P, Duan J, Cheng D, Xiang Z, Xia Q: MicroRNA expression profiling during the life cycle of the silkworm (Bombyx mori). BMC Genomics 2009, 10: 455.PubMedView Article
            50. Vanlandingham DL, Schneider BS, Klingler K, Fair J, Beasley D, Huang J, Hamilton P, Higgs S: Real-time reverse transcriptase-polymerase chain reaction quantification of West Nile virus transmitted by Culex pipiens quinquefasciatus. Am J Trop Med Hyg 2004, 71: 120–123.PubMed
            51. Beasley DW, Whiteman MC, Zhang S, Huang CY, Schneider BS, Smith DR, Gromowski GD, Higgs S, Kinney RM, Barrett AD: Envelope protein glycosylation status influences mouse neuroinvasion phenotype of genetic lineage 1 West Nile virus strains. J Virol 2005, 79: 8339–8347.PubMedView Article
            52. Scholle F, Girard YA, Zhao Q, Higgs S, Mason PW: trans-Packaged West Nile virus-like particles: infectious properties in vitro and in infected mosquito vectors. J Virol 2004, 78: 11605–11614.PubMedView Article
            53. Rossi SL, Zhao Q, O'Donnell VK, Mason PW: Adaptation of West Nile virus replicons to cells in culture and use of replicon-bearing cells to probe antiviral action. Virology 2005, 331: 457–470.PubMedView Article

            Copyright

            © Skalsky et al. 2010

            This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://​creativecommons.​org/​licenses/​by/​2.​0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

            Advertisement