Development of simple sequence repeat (SSR) markers from a genome survey of Chinese bayberry (Myrica rubra)

  • Yun Jiao1,

    Affiliated with

    • Hui-min Jia1,

      Affiliated with

      • Xiong-wei Li1,

        Affiliated with

        • Ming-liang Chai1,

          Affiliated with

          • Hui-juan Jia1,

            Affiliated with

            • Zhe Chen2,

              Affiliated with

              • Guo-yun Wang3,

                Affiliated with

                • Chun-yan Chai4,

                  Affiliated with

                  • Eric van de Weg5 and

                    Affiliated with

                    • Zhong-shan Gao1Email author

                      Affiliated with

                      BMC Genomics201213:201

                      DOI: 10.1186/1471-2164-13-201

                      Received: 4 January 2012

                      Accepted: 3 April 2012

                      Published: 23 May 2012

                      Abstract

                      Background

                      Chinese bayberry (Myrica rubra Sieb. and Zucc.) is a subtropical evergreen tree originating in China. It has been cultivated in southern China for several thousand years, and annual production has reached 1.1 million tons. The taste and high level of health promoting characters identified in the fruit in recent years has stimulated its extension in China and introduction to Australia. A limited number of co-dominant markers have been developed and applied in genetic diversity and identity studies. Here we report, for the first time, a survey of whole genome shotgun data to develop a large number of simple sequence repeat (SSR) markers to analyse the genetic diversity of the common cultivated Chinese bayberry and the relationship with three other Myrica species.

                      Results

                      The whole genome shotgun survey of Chinese bayberry produced 9.01Gb of sequence data, about 26x coverage of the estimated genome size of 323 Mb. The genome sequences were highly heterozygous, but with little duplication. From the initial assembled scaffold covering 255 Mb sequence data, 28,602 SSRs (≥5 repeats) were identified. Dinucleotide was the most common repeat motif with a frequency of 84.73%, followed by 13.78% trinucleotide, 1.34% tetranucleotide, 0.12% pentanucleotide and 0.04% hexanucleotide. From 600 primer pairs, 186 polymorphic SSRs were developed. Of these, 158 were used to screen 29 Chinese bayberry accessions and three other Myrica species: 91.14%, 89.87% and 46.84% SSRs could be used in Myrica adenophora, Myrica nana and Myrica cerifera, respectively. The UPGMA dendrogram tree showed that cultivated Myrica rubra is closely related to Myrica adenophora and Myrica nana, originating in southwest China, and very distantly related to Myrica cerifera, originating in America. These markers can be used in the construction of a linkage map and for genetic diversity studies in Myrica species.

                      Conclusion

                      Myrica rubra has a small genome of about 323 Mb with a high level of heterozygosity. A large number of SSRs were identified, and 158 polymorphic SSR markers developed, 91% of which can be transferred to other Myrica species.

                      Background

                      Chinese bayberry is an important commercial horticultural crop. It has been cultivated for more than 7,000 years in southern China, but is little known elsewhere. The production area is currently 340,000 ha, with an annual production of 1.1 million tons. The plant is diploid (2n = 16), generally dioecious, with the female plants cultivated for fruit [1], growing well on poor soils due to the association of nitrogen-fixing bacteria with the root system. It is rich in anthocyanins exhibiting a wide range of pharmacological properties, such as anti-inflammatory, antitumor and antioxidative effects [2].

                      There are four species within the genus Myrica in China, namely Myrica rubra Sieb. & Zucc., M. esculenta Buch.-Ham., M. nana Cheval., and M. adenophora Hance. M. rubra is widely distributed, with many local cultivars in the Zhejiang, Jiangsu, Fujian and Guangdong provinces and a few from Guizhou, Yunnan and Hunan provinces. The best known cultivars are Biqi and Dongkui, both from the Zhejiang province. Although there are abundant germplasm resources, studies on genetics and breeding of the species are still in their infancy. Molecular marker technology is a popular tool for breeding and genetic research, and with the construction of a genomic library, 13 polymorphic microsatellite loci have been developed in M. rubra[3] and 11 from an expressed sequence tag library [4]. Recently, 12 primer pairs have been temporarily developed by ISSR-suppression PCR [5] with GSG (GT)6 as the primer for enriching microsatellite sequences. Reports on the genetic diversity in Chinese bayberry using SSR markers have also recently been published [6, 7], but the number of markers for Chinese bayberry is limited.

                      The reproducibility, multiallelicism, co-dominance, relative abundance and good genome coverage of SSR markers have made them one of the most useful tools for genetic diversity and linkage mapping. Genomic SSRs and EST-SSRs, considered complementary to plant genome mapping, have been reported in many fruit crops, such as walnut [8], cherry [9], apricot [10] and coconut [11]. EST-SSRs are useful for genetic analysis, but their relatively low polymorphism and the high possibility of no gene-rich regions in the genome are limitations to their use. In contrast, genomic SSRs are highly polymorphic and tend to be widely distributed throughout the genome, resulting in better map coverage [12].

                      With genetic maps serving as the basis for future positional gene cloning, making map-based cloning and marker-assisted selection possible, the development of more SSRs is essential. As sequencing technologies advance, whole-genome shotgun (WGS) sequences are becoming increasingly available. These DNA sequences are valuable resources for SSR development in many plant species, such as rice [13] and papaya [14]. In addition, they can be used to evaluate the frequency and distribution of different types of SSRs in the genome, and even help to estimate genome size and characters such as heterozygosis and repeats.

                      As a way of reducing the cost of genotyping research, Schuelke [15] proposed a method for fluorescent dye labelling of PCR fragments with a sequence-specific forward primer: the universal fluorescent-labelled M13(-21) primer, at the 5 end, acts as the forward primer in a ‘one-tube’ reaction. As this method allows for high-throughput genetic analyses, with a high number of microsatellite markers widely used, we considered the possibility of using this approach for multiplex PCR, to improve the efficiency and save costs.

                      In this study, we mined and validated 158 SSR markers and describe their application for understanding the genetic relationship among 29 Chinese bayberry accessions and other Myrica species. These markers are useful for genotyping and genetic diversity analysis and linkage mapping of Myrica rubra and other Myrica species.

                      Results

                      Genome survey using whole genome shotgun data in Chinese bayberry

                      WGS generated 273,161 (>100 bp) high quality sequence reads from two DNA libraries (250 bp and 500 bp) of the androphyte individual ‘C2010-55’. We used 9.01 G raw data for K-mer analysis and heterozygous simulation. For the 17-mer frequency distribution (Figure 1), the peak of the depth distribution was about 22. The estimated genome size was 323 Mb, using the formula: genome size = k-mer count/peak of the kmer distribution. The minor peak at 1/2 altitude of the main peak indicates the high level of heterozygosity in this genome (Figure 1). A total of 739,969 contigs were assembled with a total sequence length of 255.7 Mb. The length of N50 was 295 bp in our assembly, and the longest contig and scaffold 7,593 and 127,008 bp, respectively.
                      http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-13-201/MediaObjects/12864_2012_4370_Fig1_HTML.jpg
                      Figure 1

                      The distribution of 17-mer depth analysis based on whole genome shotgun data in Chinese bayberry.

                      Frequency distribution of different types of SSR markers

                      A total of 17,172 out of 273,161 scaffolds (6%) retrieved from the genome survey sequence contained 28,602 SSRs (Table 1), of which 5,401 contained more than one SSR, and 1,444 SSRs were present in compound format. Among the derived SSR repeats, the di-nucleotide was the most abundant repeat, accounting for 84.72% of total SSRs, followed by tri- (13.78%), tetra- (1.34%), penta- (0.12%), and hexa- (0.04%) nucleotides (Table 1). There was a large proportion of both dinucleotides and trinucleotides while the rest amounted to less 2%. The average frequency of occurrence was about 10.47% (Table 1).
                      Table 1

                      Occurrence of SSRs in the Genome Survey of Chinese bayberry

                      Type

                      Number

                      Proportion in all SSRs (%)

                      Frequency (%)

                      Dinucleotide

                      24,233

                      84.72%

                      8.87%

                      Trinucleotide

                      3,941

                      13.78%

                      1.44%

                      Tetranucleotide

                      383

                      1.34%

                      0.14%

                      Pentanucleotide

                      35

                      0.12%

                      0.013%

                      Hexanucleotide

                      10

                      0.04%

                      0.004%

                      Total

                      28,602

                      100%

                      10.47%

                      The SSR frequency of each motif is presented in Additional file 1. The SSR motif consists of 69 types. Among the repeat motifs of the dinucleotide, the AG/CT repeat was the most common, representing 53.72%, followed by 39.20% AT repeats (Figure 2), and the predominant motifs of trinucleotide (AAG/CTT and AAT/ATT) repeats accounted for 37.15% and 32.56%, respectively (Figure 3).
                      http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-13-201/MediaObjects/12864_2012_4370_Fig2_HTML.jpg
                      Figure 2

                      Percentage of different motifs in dinucleotide repeats in Chinese bayberry genome.

                      http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-13-201/MediaObjects/12864_2012_4370_Fig3_HTML.jpg
                      Figure 3

                      Percentage of different motifs in trinucleotide repeats in Chinese bayberry genome.

                      Polymorphism of SSR markers

                      We first designed and synthesised 600 SSR primer pairs from those scaffolds more than 2Kb long. The majority of SSR loci were dinucleotide repeats (597, 99.5%), and the remainder trinucleotide. Initially, the effectiveness of these primer pairs was detected in two cultivars (Biqi and Dongkui) and M. cerifera through denaturing PAGE (Polyacrylamide gel electrophoresis), and 581 (96.8%) of these were amplified successfully in Biqi and Dongkui, and 400 (66.7%) in M. cerifera. The SSR loci (186, 31%) were identified as heterozygous loci either in Biqi or in Dongkui. Subsequently, they were used to screen 32 accessions, and detected an average of 8.25 alleles and from 3 to 15 alleles per locus (Table 2).
                      Table 2

                      Characteristics of 158 SSR markers in this study

                      Locus

                      GenBank

                      Repeat motif

                      Primer sequence (5'-3')

                      Size range(bp)a

                      Na

                      Ho

                      He

                      PIC

                      P HW

                       

                      Accession

                              

                      ZJU001ab

                      JQ318696

                      (GA)10

                      F:<NED > <Tail-1 > CCTCTCCACCCATGAGAAAC

                      160-188

                      7

                      0.1667

                      0.4271

                      0.4002

                      0.0000

                      R:CAAATCATTCCCTGCTTTCC

                      ZJU002ac

                      JQ318697

                      (TC)13

                      F:<NED > <Tail-1 > TCAAAGAGACGTTGTGGCAG

                      219-229

                      4

                      0.2083

                      0.5257

                      0.4572

                      0.0005

                      R:TCCGCTCACAGACAGAGAGA

                      ZJU003ab

                      JQ318698

                      (AG)11

                      F:<NED > <Tail-1 > GTCACCTTGCTCTTCTTGGC

                      203-217

                      8

                      0.7407

                      0.8344

                      0.7949

                      0.0003

                      R:TCCTTGTACTTGTTCTGCTGGA

                      ZJU004ac

                      JQ318699

                      (GA)10

                      F:<NED > <Tail-1 > AACAGAACCATCGTCAAGGC

                      204-210

                      4

                      0.3571

                      0.7325

                      0.6704

                      0.0003

                      R:GGTACAGTCGCTCCGGTTTA

                      ZJU005ab

                      JQ318700

                      (AG)14

                      F:<NED > <Tail-1 > CTTTGGACATGGCAACACAC

                      200-228

                      11

                      0.3000

                      0.8679

                      0.8291

                      0.0000

                      R:TCCACTTTGACAGATTCCCA

                      ZJU006ab

                      JQ318701

                      (GA)10

                      F:<NED > <Tail-1 > CTCGCCCTCTCTCTCTACCA

                      193-205

                      5

                      0.2593

                      0.3305

                      0.3089

                      0.0000

                      R:AGTTTATCCACCCGTGTCGT

                      ZJU007ab

                      JQ318702

                      (AG)13

                      F:<NED > <Tail-1 > TGATCCATTGGAACCATGTG

                      193-209

                      8

                      0.5625

                      0.6617

                      0.6302

                      0.1868

                      R:TCAGTTGATGGTGCAGAAGC

                      ZJU008ab

                      JQ318703

                      (CT)10

                      F:<NED > <Tail-1 > GGAGAAATGAACGGTGGAGA

                      191-215

                      10

                      0.7931

                      0.7973

                      0.7563

                      0.0002

                      R:TCCAAAGCTAATACCCACGC

                      ZJU009ab

                      JQ318704

                      (CT)10

                      F:<NED > <Tail-1 > AATTGTCGCAAGTAGTCGCC

                      207-221

                      5

                      0.0741

                      0.3599

                      0.3371

                      0.0000

                      R:ATATCAACCCATGGGAGCAA

                      ZJU010ab

                      JQ318705

                      (CT)11

                      F:<NED > <Tail-1 > TGCAACATCGAAATTGGAAA

                      181-205

                      9

                      0.9032

                      0.8012

                      0.7614

                      0.0000

                      R:ATGCCGGCAAGTCTTAGTGT

                      ZJU011a

                      JQ318706

                      (GA)10

                      F:<NED > <Tail-1 > GGAGGCTCGTCAGTCATCTC

                      200-216

                      9

                      0.2692

                      0.7926

                      0.7554

                      0.0000

                      R:TTAGCGTCCCTTCTCTCTCG

                      ZJU012ab

                      JQ318707

                      (CT)12

                      F:<NED > <Tail-1 > CTTCACTCACCGCCTTTCTC

                      184-218

                      13

                      0.5000

                      0.8571

                      0.8251

                      0.0000

                      R:AATGGCCTCCACATCTCAAG

                      ZJU013ab

                      JQ318708

                      (CT)10

                      F:<NED > <Tail-1 > ACTTGTCATTCCCACGTTCC

                      211-221

                      6

                      0.4444

                      0.5199

                      0.4515

                      0.0094

                      R:CACTCCATCTCAACCACCCT

                      ZJU014ab

                      JQ318709

                      (AG)15

                      F:<NED > <Tail-1 > TGGAATGTCGATCTGAAACAA

                      186-212

                      13

                      0.6875

                      0.9033

                      0.8791

                      0.0251

                      R:ACCAGCTTATACGACGGTGG

                      ZJU015ab

                      JQ318710

                      (GA)11

                      F:<NED > <Tail-1 > TTGGTGTGGTGGTAATGGTG

                      199-221

                      6

                      0.6154

                      0.6614

                      0.5902

                      0.0585

                      R:AAATAATGCAAGCAGGTGGG

                      ZJU016ab

                      JQ318711

                      (TC)10

                      F:<NED > <Tail-1 > CCGTTGACTATTGCCCAGTT

                      196-216

                      11

                      0.6333

                      0.8469

                      0.8130

                      0.0179

                      R:GGCAATTTCCAAATCGCTAA

                      ZJU017ab

                      JQ318712

                      (CT)13

                      F:<NED > <Tail-1 > ACTGAAGAACCAAACGTGGG

                      180-200

                      6

                      0.6250

                      0.7093

                      0.6518

                      0.0003

                      R:GGTGTGTTTCTCTGTGTGCG

                      ZJU018ab

                      JQ318713

                      (CT)15

                      F:<NED > <Tail-1 > ACGAAATTTGACCAATCGCT

                      196-216

                      7

                      0.1429

                      0.7189

                      0.6667

                      0.0000

                      R:AGGGTTTCTTCTGGTTCGGT

                      ZJU019ab

                      JQ318714

                      (GA)12

                      F:<NED > <Tail-1 > TTTCATAACCCGTTGGCTTC

                      209-219

                      6

                      0.2800

                      0.6865

                      0.6317

                      0.0000

                      R:AAGGTGGAAACGTGTCAAGG

                      ZJU020b

                      JQ318715

                      (AG)10

                      F:<NED > <Tail-1 > CACAGGACATGTGATGGAGG

                      201-213

                      7

                      0.5172

                      0.7453

                      0.6983

                      0.0000

                      R:CCATCCTGAGCTTTGTCGAT

                      ZJU021a

                      JQ318716

                      (TG)10

                      F:<NED > <Tail-1 > TCGCCAGCTTCCTAATGTCT

                      190-212

                      8

                      0.7778

                      0.7428

                      0.7025

                      0.0663

                      R:GAGCGCATGTTGTTGCTAAA

                      ZJU022ab

                      JQ318717

                      (GA)10

                      F:<NED > <Tail-1 > AAGCTTAAGCAAGCGTCGAG

                      188-208

                      9

                      0.6923

                      0.8575

                      0.8227

                      0.0109

                      R:TGCGAAGGGAAATTTCAGAC

                      ZJU023ac

                      JQ318718

                      (AG)15

                      F:<NED > <Tail-1 > GTGTTTGGGCAGCACCTATT

                      200-226

                      14

                      0.6667

                      0.8840

                      0.8544

                      0.0251

                      R:AAAGAGTACAACAACGCGGG

                      ZJU024ab

                      JQ318719

                      (TC)10

                      F:<NED > <Tail-1 > CCGCATGTTTGATTGATGTC

                      180-196

                      6

                      0.6000

                      0.7345

                      0.6716

                      0.1624

                      R:GCGTTGAGCGGAGAGATTAC

                      ZJU025ab

                      JQ318720

                      (TC)10

                      F:<NED > <Tail-1 > TTTGAGCGATAGTACGGAGG

                      216-234

                      8

                      0.2667

                      0.7537

                      0.7044

                      0.0000

                      R:ATATGCTACGTTGGTTGCCC

                      ZJU026ab

                      JQ318721

                      (TC)10

                      F:<NED > <Tail-1 > CCAGACAGGTTAGCCACCAT

                      200-220

                      10

                      0.4545

                      0.8573

                      0.8199

                      0.0000

                      R:GCCTCTGGATCTCGATTACG

                      ZJU027

                      JQ318722

                      (TTC)8

                      F:<NED > <Tail-1 > GTTGCAATTTGCCTCCATTT

                      203-227

                      6

                      0.3125

                      0.6250

                      0.5321

                      0.0003

                      R:GGTGCCTATACTGCCAGCTC

                      ZJU028ab

                      JQ318723

                      (AG)10

                      F:<NED > <Tail-1 > CAACCATCCAAACCAAATCC

                      164-170

                      4

                      0.1724

                      0.2789

                      0.2566

                      0.0000

                      R:TCTACCAATCGTGGCTAGGG

                      ZJU029ab

                      JQ318724

                      (AG)10

                      F:<NED > <Tail-1 > TCTTCCGGGATGTCTACAGG

                      189-205

                      6

                      0.5312

                      0.6925

                      0.6296

                      0.0480

                      R:CAACAGCAATCGCAAAGAAA

                      ZJU030ab

                      JQ318725

                      (CA)13

                      F:<NED > <Tail-1 > AAGTGAGCTCTCCCTCCCTC

                      193-205

                      7

                      0.4286

                      0.7208

                      0.6676

                      0.0000

                      R:CACCGAAATACTTGCCGTTT

                      ZJU031ab

                      JQ318726

                      (GA)16

                      F:<NED > <Tail-1 > GCACAGGAACACCAGGATCT

                      179-195

                      8

                      0.8387

                      0.7948

                      0.7492

                      0.0000

                      R:CCAAGCCCTAATTCCCTTTC

                      ZJU032ab

                      JQ318727

                      (TC)11

                      F:<NED > <Tail-1 > ATTCCCACGTTCGTTCAGAC

                      204-226

                      8

                      0.6786

                      0.6442

                      0.5852

                      0.0220

                      R:GATGCCTAACTCCGAATCCA

                      ZJU033ab

                      JQ318728

                      (TC)10

                      F:<NED > <Tail-1 > GCACAAGTTGCTGACATGCT

                      195-207

                      6

                      0.0690

                      0.6655

                      0.5897

                      0.0000

                      R:AGTTGCATTCAACCCACACA

                      ZJU034ab

                      JQ318729

                      (CT)10

                      F:<NED > <Tail-1 > ATGGGAATGTGGAGAACGAG

                      191-209

                      8

                      0.4138

                      0.7762

                      0.7250

                      0.0000

                      R:GCTTTGCTTCTTTGCTTTGG

                      ZJU035ab

                      JQ318730

                      (GA)14

                      F:<NED > <Tail-1 > TTGGATCCTGGTTACCTTCG

                      201-217

                      8

                      0.1290

                      0.7425

                      0.6900

                      0.0000

                      R:AAACTGCATGCATGGTTCCT

                      ZJU036ab

                      JQ318731

                      (GA)10

                      F:<NED > <Tail-1 > CTGCCACTCTTACTGGCCTC

                      186-214

                      8

                      0.3333

                      0.5895

                      0.5516

                      0.0000

                      R:ATGTGCCCAATCTTGACTCC

                      ZJU037ab

                      JQ318732

                      (TC)10

                      F:<NED > <Tail-1 > GTGATTTCCCTCCCATTGAC

                      208-228

                      9

                      0.8125

                      0.7867

                      0.7429

                      0.0135

                      R:ACGAAGCGGGAAGTAGGATT

                      ZJU038b

                      JQ318733

                      (AG)10

                      F:<NED > <Tail-1 > CTTATGGCCCGTTTGTAACC

                      194-200

                      4

                      0.2273

                      0.5106

                      0.4646

                      0.0007

                      R:AACGATTGCTTTAAGCGGAA

                      ZJU039a

                      JQ318734

                      (CT)10

                      F:<NED > <Tail-1 > AAACGAAAGTGGGCGTATTG

                      219-229

                      6

                      0.3077

                      0.6161

                      0.5745

                      0.0004

                      R:CACCAGTGCGTCCTATGAGA

                      ZJU040

                      JQ318735

                      (TC)16

                      F:<NED > <Tail-1 > AAACTCCGTGCTGGAATCAA

                      198-220

                      10

                      0.3182

                      0.8192

                      0.7798

                      0.0000

                      R:GCAGACAAGCCTTCCTGTTC

                      ZJU041ab

                      JQ318736

                      (TC)11

                      F:<PET > <Tail-2 > TGATCACCTTTCAGTTGGCA

                      226-244

                      5

                      0.2258

                      0.3199

                      0.3031

                      0.0000

                      R:CACATTGGCAGAGTCCTGAA

                      ZJU042ab

                      JQ318737

                      (TC)10

                      F:<PET > <Tail-2 > AGGATTTCTCCAGAGGGACG

                      220-242

                      5

                      0.3571

                      0.5331

                      0.4880

                      0.0000

                      R:GGTTCCGCATCAAACTACAAA

                      ZJU043b

                      JQ318738

                      (CT)10

                      F:<PET > <Tail-2 > AAACCGAGCTCTCCTAAGCC

                      225-245

                      4

                      0.5714

                      0.6383

                      0.5667

                      0.2655

                      R:CTCGCAATTTCTCGGGATAC

                      ZJU044ab

                      JQ318739

                      (GA)12

                      F:<PET > <Tail-2 > GATGGTGGCTTGTCTTGGTT

                      235-255

                      8

                      0.2500

                      0.5091

                      0.4853

                      0.0000

                      R:AAGTGGGACGTCAATTCCTG

                      ZJU045ab

                      JQ318740

                      (CT)10

                      F:<PET > <Tail-2 > GAGAGAGGGAGAGAGGCCAT

                      228-258

                      13

                      0.6129

                      0.8821

                      0.8544

                      0.0007

                      R:GGAAGATTCATGGGAGAGGG

                      ZJU046ab

                      JQ318741

                      (AG)10

                      F:<PET > <Tail-2 > TTGCTGTAAGCATCGCAATC

                      226-242

                      7

                      0.3871

                      0.6256

                      0.5824

                      0.0000

                      R:AAGCTCCGGTAACACACACC

                      ZJU047ab

                      JQ318742

                      (GA)13

                      F:<PET > <Tail-2 > TTCGATCATTCATGAGGCTG

                      247-259

                      7

                      0.7097

                      0.7615

                      0.7074

                      0.0019

                      R:TTAATTGCATCCCGGATTTC

                      ZJU048ab

                      JQ318743

                      (CT)14

                      F:<PET > <Tail-2 > AGCGGACCGAGTTGTAGAGA

                      230-254

                      12

                      0.2903

                      0.8493

                      0.8166

                      0.0000

                      R:CCAACCCTACAAAGCGAGAG

                      ZJU049ab

                      JQ318744

                      (GAA)8

                      F:<PET > <Tail-2 > GTGTCTGCAGCAACTTCCAC

                      234-267

                      10

                      0.8125

                      0.7262

                      0.6797

                      0.0000

                      R:GTCGGAACCGAAGATGGTTA

                      ZJU050ab

                      JQ318745

                      (AG)11

                      F:<PET > <Tail-2 > GTCACAGCCTGGATAGCTCC

                      233-245

                      7

                      0.3000

                      0.7288

                      0.6916

                      0.0000

                      R:GTCTCTCCTGGATGAGCTGC

                      ZJU051ab

                      JQ318746

                      (AG)12

                      F:<PET > <Tail-2 > AGAGAAAGACCGGGACCAAT

                      229-233

                      3

                      0.4333

                      0.4198

                      0.3594

                      0.0012

                      R:GAGAAATAAAGCCGAGCGTG

                      ZJU052ab

                      JQ318747

                      (AG)16

                      F:<PET > <Tail-2 > CCCGAGCTGAACGAAATAGA

                      230-248

                      9

                      0.4348

                      0.8628

                      0.8261

                      0.0000

                      R:GGATCAAAGCGTTGTCGTTT

                      ZJU053ab

                      JQ318748

                      (AG)10

                      F:<PET > <Tail-2 > AAATCCGAAACACCTCTCCC

                      222-240

                      8

                      0.5000

                      0.5655

                      0.5211

                      0.0001

                      R:ATGTGGAGACTTCCACTGGG

                      ZJU054ab

                      JQ318749

                      (CT)13

                      F:<PET > <Tail-2 > TTGATTTGCTTTGTGCATTTG

                      232-250

                      9

                      0.3000

                      0.8667

                      0.8268

                      0.0003

                      R:CAAACTACCGTGCCCAACAT

                      ZJU055ab

                      JQ318750

                      (CT)10

                      F:<PET > <Tail-2 > TTATGGGTTTCATTGGGCAG

                      238-254

                      6

                      0.2500

                      0.7006

                      0.6357

                      0.0000

                      R:TCACCAGGCTACTGCATGTC

                      ZJU056ab

                      JQ318751

                      (GA)13

                      F:<PET > <Tail-2 > GACAAAGTGGGTGCCATTCT

                      230-246

                      7

                      0.5714

                      0.7643

                      0.7122

                      0.0068

                      R:TGCATGCTTCCTTTCTTCCT

                      ZJU057ab

                      JQ318752

                      (CT)10

                      F:<PET > <Tail-2 > TCATGTGGAGATTGAAGCCA

                      230-244

                      6

                      0.1579

                      0.6814

                      0.6283

                      0.0000

                      R:CGTCCCGAATGAAGATTTGT

                      ZJU058ab

                      JQ318753

                      (GT)10

                      F:<PET > <Tail-2 > TCCGGAGCTTTCAATCTCAT

                      252-274

                      11

                      0.7500

                      0.8274

                      0.7900

                      0.8036

                      R:GCCTACGAACTCAGGTTCCA

                      ZJU059b

                      JQ318754

                      (TC)14

                      F:<PET > <Tail-2 > TGTTTGTTTCTTGCTATTTCCATC

                      217-235

                      7

                      0.5200

                      0.7935

                      0.7505

                      0.0016

                      R:GACAGTTCCCACCAGCATTT

                      ZJU060ab

                      JQ318755

                      (GT)8(GA)9

                      F:<PET > <Tail-2 > TGGCCAGGAACTTTGTATCC

                      223-243

                      7

                      0.6562

                      0.8110

                      0.7691

                      0.0000

                      R:GAAAGATTGGGAATGCTGGA

                      ZJU061ab

                      JQ318756

                      (TC)11

                      F:<PET > <Tail-2 > TTTGGAGGAAGCAAACAAGC

                      204-232

                      11

                      0.2812

                      0.7922

                      0.7506

                      0.0000

                      R:TCCTGCGCCAACAATCTAAT

                      ZJU062

                      JQ318757

                      (TC)10

                      F:<PET > <Tail-2 > GTCGAGAGAACAAAGCGACC

                      240-252

                      7

                      0.2400

                      0.3282

                      0.3135

                      0.0004

                      R:GTCCAATGCCGCACTAACTT

                      ZJU063ab

                      JQ318758

                      (TC)12

                      F:<PET > <Tail-2 > ACTCAGCAGGACCACCAACT

                      232-250

                      10

                      0.7000

                      0.8593

                      0.8270

                      0.1320

                      R:TTAGACGGAAATTGGGCTTG

                      ZJU064b

                      JQ318759

                      (GA)10

                      F:<PET > <Tail-2 > ACCATGAAGCTGACCTGGAG

                      226-244

                      6

                      0.4348

                      0.7256

                      0.6666

                      0.0001

                      R:TTTCGTGGTCCCACCTACTC

                      ZJU065ac

                      JQ318760

                      (CA)13

                      F:<PET > <Tail-2 > TCCAGAATATCATCTCTTGCCA

                      214-236

                      9

                      0.6333

                      0.7706

                      0.7219

                      0.0001

                      R: ATATTCCTAACGTGTGCGGG

                      ZJU066ab

                      JQ318761

                      (GA)10

                      F:<PET > <Tail-2 > CTTTCCCTTGTCGCTTTCAG

                      221-235

                      8

                      0.2593

                      0.6450

                      0.6075

                      0.0000

                      R:GGTCGCAGATCAGGTCAAGT

                      ZJU067ab

                      JQ318762

                      (CT)10

                      F:<PET > <Tail-2 > CAGACAGCGAGGAGACAACA

                      217-263

                      11

                      0.6923

                      0.8273

                      0.7861

                      0.0070

                      R:GGTCTTTCGAACTTTGCTCG

                      ZJU068ab

                      JQ318763

                      (CT)10

                      F:<PET > <Tail-2 > GAAGCTAAACGCCAGAAACG

                      227-239

                      6

                      0.2917

                      0.7535

                      0.6913

                      0.0000

                      R:ACTCCTCACACGAATGGGTC

                      ZJU069bc

                      JQ318764

                      (GA)10

                      F:<PET > <Tail-2 > TGCCATAATCCTGAGAGCCT

                      224-258

                      8

                      0.2609

                      0.5594

                      0.5235

                      0.0004

                      R:TGTTCTGTAATGGCGTGGAA

                      ZJU070ab

                      JQ318765

                      (CT)11

                      F:<PET > <Tail-2 > GTGCTCGAGATGTCCTCCAT

                      221-247

                      7

                      0.5200

                      0.7861

                      0.7364

                      0.0000

                      R:ACAATCCCATCGCATACAGG

                      ZJU071ab

                      JQ318766

                      (GA)10

                      F:<PET > <Tail-2 > CTAAGGTTGGTCCCTGTCCA

                      228-234

                      3

                      0.3704

                      0.6157

                      0.5305

                      0.0110

                      R:CTTGTGTGGTGATGGTTTGG

                      ZJU072ab

                      JQ318767

                      (AG)10

                      F:<PET > <Tail-2 > AGTCAGCGTGGGAATGTACC

                      223-237

                      7

                      0.5625

                      0.7604

                      0.7117

                      0.0000

                      R:TTTCAGAACAAGTTCGTCGC

                      ZJU073a

                      JQ318768

                      (AG)12

                      F:<PET > <Tail-2 > TACGCCAAGATCCAAAGACC

                      222-242

                      7

                      0.2105

                      0.7568

                      0.7087

                      0.0000

                      R:TCTCGAGTTGAGTTTGGGCT

                      ZJU074ab

                      JQ318769

                      (CT)15

                      F:<PET > <Tail-2 > TGCAGAGGAACTGGTGACTG

                      215-239

                      10

                      0.5517

                      0.8234

                      0.7831

                      0.0007

                      R:GAGAAGGCTCAGTGGGTGAG

                      ZJU075b

                      JQ318770

                      (CT)17

                      F:<PET > <Tail-2 > AATAAACACACAGGGCGAGG

                      239-255

                      9

                      0.0769

                      0.8650

                      0.8307

                      0.0000

                      R:ATCGGGCAGACCAGAATATG

                      ZJU076ab

                      JQ318771

                      (AG)9

                      F:<FAM > <Tail-3 > ATGGTTACCGACGTCCTCTG

                      131-169

                      11

                      0.8438

                      0.8353

                      0.8034

                      0.0000

                      R:AGTGCAGAGTGCGAGATCAA

                      ZJU077ab

                      JQ318772

                      (AC)9

                      F:<FAM > <Tail-3 > TTTGGAATTCAACAACATTTAGAC

                      137-153

                      8

                      0.2000

                      0.6590

                      0.6079

                      0.0000

                      R:TGCAGCCTTGCTCCTCTTAT

                      ZJU078ab

                      JQ318773

                      (TC)10

                      F:<FAM > <Tail-3 > ACACCACGGTTCTTCGATTC

                      130-146

                      6

                      0.5500

                      0.7513

                      0.6881

                      0.1339

                      R:GTAACGAGGCTCTTGCTTGC

                      ZJU079ab

                      JQ318774

                      (TC)13

                      F:<FAM > <Tail-3 > AAGGCTAGACCGCAATCTGA

                      116-134

                      9

                      0.8438

                      0.8596

                      0.8291

                      0.0008

                      R:GGGCAACAGTTTACTTCCCA

                      ZJU080ab

                      JQ318775

                      (CT)9

                      F:<FAM > <Tail-3 > CTTGACGAAATGCAGACGAA

                      124-134

                      5

                      0.2903

                      0.3411

                      0.3172

                      0.0103

                      R:TCCGGATCAGGGTCAAATAG

                      ZJU081ab

                      JQ318776

                      (GA)8

                      F:<FAM > <Tail-3 > TGCTCTTGCAGAGAGTCGAG

                      137-157

                      6

                      0.5517

                      0.5820

                      0.5379

                      0.0003

                      R:TCATAATACCCTTGGCAAACA

                      ZJU082ab

                      JQ318777

                      (CT)10

                      F:<FAM > <Tail-3 > TATATCGAATCCCAAAGGCG

                      129-141

                      5

                      0.3438

                      0.4043

                      0.3792

                      0.0169

                      R:AAGATATTGGTCCGGCTCCT

                      ZJU083ab

                      JQ318778

                      (AG)10

                      F:<FAM > <Tail-3 > TAGCCTTGGAGATTTAGGGC

                      133-157

                      11

                      0.8667

                      0.8960

                      0.8692

                      0.0000

                      R:TTGAAATTTCGCAGCCTCTT

                      ZJU084ab

                      JQ318779

                      (AG)9

                      F:<FAM > <Tail-3 > TTTCGATTGGTGGTCTGTGA

                      124-138

                      6

                      0.1379

                      0.5197

                      0.4766

                      0.0000

                      R:TTATTAACTTCACTTTGTTTATTCGG

                      ZJU085ab

                      JQ318780

                      (AG)9

                      F:<FAM > <Tail-3 > GCTTTAACCGAGTGATGGGA

                      150-184

                      8

                      0.6875

                      0.5992

                      0.5383

                      0.6352

                      R:TAAAGGAGCGCTGGAAAGAA

                      ZJU086ab

                      JQ318781

                      (TC)10

                      F:<FAM > <Tail-3 > TCCTCTCTTTCACACTTCCGA

                      118-152

                      13

                      0.9062

                      0.8720

                      0.8445

                      0.0005

                      R:GGTCGATCATTTCTCTCCCA

                      ZJU087ab

                      JQ318782

                      (GA)9

                      F:<FAM > <Tail-3 > CGAGTGTAGCTAGGAACGGC

                      135-149

                      8

                      0.4688

                      0.7748

                      0.7273

                      0.0204

                      R:AATTGGACCTGCAAATCTCG

                      ZJU088ab

                      JQ318783

                      (CT)9

                      F:<FAM > <Tail-3 > GAGCTCCGAACTTCTTCCCT

                      126-150

                      13

                      0.9677

                      0.8773

                      0.8490

                      0.0053

                      R:CTTCTCCACAGGACTCTGCC

                      ZJU089ab

                      JQ318784

                      (GA)8

                      F:<FAM > <Tail-3 > CGTTAGGATTCGGGAACAGA

                      138-152

                      7

                      0.8065

                      0.7382

                      0.6778

                      0.0000

                      R:CAGGGCTAATGTGGACCAGT

                      ZJU090ab

                      JQ318785

                      (AG)9

                      F:<FAM > <Tail-3 > GGAAATCTCCGAATGTGATCC

                      118-134

                      8

                      0.2903

                      0.6642

                      0.6089

                      0.0000

                      R:TGGTGGATGAACCACTCAAA

                      ZJU091bc

                      JQ318786

                      (TC)15

                      F:<FAM > <Tail-3 > AAAGAGCACACAGCCCTAGC

                      124-146

                      10

                      0.4615

                      0.8695

                      0.8358

                      0.0012

                      R:GGCAGTGTCGCAGTGATAGA

                      ZJU092ab

                      JQ318787

                      (TG)10

                      F:<FAM > <Tail-3 > CTCTTGCCGACCTCATTGTT

                      127-151

                      11

                      0.6875

                      0.8264

                      0.7916

                      0.0041

                      R:CGGGACTCGCATAAATCACT

                      ZJU093ab

                      JQ318788

                      (GA)10

                      F:<FAM > <Tail-3 > ATGCCATGTTGCATGAGTGT

                      130-156

                      12

                      0.9355

                      0.8662

                      0.8367

                      0.3689

                      R:TATCCCGTAAGCAATCAGGG

                      ZJU094ab

                      JQ318789

                      (CT)10

                      F:<FAM > <Tail-3 > ATCACGGGTTCTGCTGTTCT

                      124-150

                      10

                      0.9062

                      0.8646

                      0.8332

                      0.0000

                      R:CAGAAGAAGCCATTTCTGCC

                      ZJU095ab

                      JQ318790

                      (AG)9

                      F:<FAM > <Tail-3 > TACCCACCGTACCAAAGGTC

                      114-130

                      7

                      0.4839

                      0.7070

                      0.6420

                      0.0004

                      R:GAATGAACCCAGGCGATAGA

                      ZJU096ab

                      JQ318791

                      (CT)10

                      F:<FAM > <Tail-3 > CATACTGCAATGCATCTCCC

                      126-154

                      13

                      0.8000

                      0.8757

                      0.8479

                      0.0310

                      R:TCAATTTGTGTGCCCTTACG

                      ZJU097ab

                      JQ318792

                      (AG)10

                      F:<FAM > <Tail-3 > AATTGTTAGGGAGGGCTCGT

                      118-134

                      8

                      0.8438

                      0.7778

                      0.7297

                      0.0009

                      R:TGCGTTGTGGAGACCATTTA

                      ZJU098ab

                      JQ318793

                      (CT)9

                      F:<FAM > <Tail-3 > GACGCTCCATCTCTGGTCTC

                      145-167

                      10

                      0.9355

                      0.8831

                      0.8549

                      0.0483

                      R:CCCAAACCGCACTAGAGAAA

                      ZJU099ab

                      JQ318794

                      (GA)10

                      F:<FAM > <Tail-3 > TTGTTGCACTTGTGGGTGAT

                      130-150

                      9

                      0.7742

                      0.7763

                      0.7299

                      0.0000

                      R:AACTACAAACAGCCCAACCG

                      ZJU100ab

                      JQ318795

                      (TC)9

                      F:<FAM > <Tail-3 > ACTTGTCCGGATTCCACAAC

                      128-154

                      5

                      0.8333

                      0.6316

                      0.5629

                      0.2930

                      R:TCAAGGCACACAATAATGCAA

                      ZJU101ab

                      JQ318796

                      (AG)9

                      F:<FAM > <Tail-3 > TGATTGAGCTGCCAACAAAG

                      134-154

                      7

                      0.6667

                      0.7062

                      0.6527

                      0.8110

                      R:TTTAACATTTGGCACCGACA

                      ZJU102ab

                      JQ318797

                      (GA)10

                      F:<FAM > <Tail-3 > GAACCACGAACTTCAACCGT

                      118-132

                      8

                      0.4231

                      0.5890

                      0.5441

                      0.0111

                      R:AACCACCAAACTTAGCTTCCA

                      ZJU103ab

                      JQ318798

                      (AG)9

                      F:<FAM > <Tail-3 > TGAGGAGGGAGTTGAGTTGG

                      121-139

                      10

                      0.7097

                      0.7731

                      0.7359

                      0.0003

                      R:GCGTCTTCCTCCTCCTTCTT

                      ZJU104ab

                      JQ318799

                      (TA)9

                      F:<FAM > <Tail-3 > ACGTGGCAGTTGAGTTGTTG

                      114-128

                      6

                      0.3704

                      0.6296

                      0.5702

                      0.1383

                      R:TCAGATCTCCGTTGGAGCTT

                      ZJU105ab

                      JQ318800

                      (GA)11

                      F:<FAM > <Tail-3 > TGAGAAACGCAGCAAGAGAA

                      135-157

                      11

                      0.5806

                      0.8165

                      0.7801

                      0.0000

                      R:CATCTCTCCCAAGCATCCTC

                      ZJU106ab

                      JQ318801

                      (GA)8

                      F:<FAM > <Tail-3 > GCAGTCGGATAGAGAGACGG

                      134-146

                      7

                      0.3636

                      0.7717

                      0.7203

                      0.0000

                      R:TGTTGATCAAACACACCGAGA

                      ZJU107ab

                      JQ318802

                      (TC)10

                      F:<FAM > <Tail-3 > TGGTGTCACGATTCACTGGT

                      114-130

                      8

                      0.4375

                      0.5322

                      0.5012

                      0.3632

                      R:CTGCATGTAATGGCAGTTCAA

                      ZJU108b

                      JQ318803

                      (CT)9

                      F:<FAM > <Tail-3 > TTGGTAGTGCACTGCAGGAG

                      132-160

                      13

                      0.3929

                      0.8253

                      0.7909

                      0.0000

                      R:CGAGGGTCGAGTTCAGAGAG

                      ZJU109ab

                      JQ318804

                      (TC)10

                      F:<FAM > <Tail-3 > TCCGCTCTCCTCTCTGTCTC

                      138-164

                      11

                      0.8000

                      0.8441

                      0.8082

                      0.0003

                      R:GTGAGTTGTGCTGCTGCAAT

                      ZJU110ab

                      JQ318805

                      (AG)9

                      F:<FAM > <Tail-3 > TTGCACGGTGGTAGCTGTAG

                      143-159

                      5

                      0.7667

                      0.6486

                      0.5844

                      0.0000

                      R:ACTGTGGTCCGTCGAACTCT

                      ZJU111ab

                      JQ318806

                      (TC)8

                      F:<FAM > <Tail-3 > TTTCTAATGTTGTTCGCCCA

                      122-136

                      5

                      0.9000

                      0.5701

                      0.4652

                      0.0000

                      R:TCATTCTCCTTGCAGATCCC

                      ZJU112ac

                      JQ318807

                      (GA)8

                      F:<FAM > <Tail-3 > GGAGAGTGAGAGATCGCAGC

                      133-147

                      8

                      0.4839

                      0.6557

                      0.6212

                      0.0009

                      R:GGCAACACCCTCAGTATCGT

                      ZJU113ab

                      JQ318808

                      (AG)9

                      F:<FAM > <Tail-3 > AAACGCACCAGAGAAAGACG

                      138-154

                      6

                      0.6667

                      0.6588

                      0.5987

                      0.0130

                      R:TCCATCTCTGGTCTCCATCC

                      ZJU114a

                      JQ318809

                      (GA)10

                      F:<FAM > <Tail-3 > CTAGAGCGCTCCACGATACC

                      132-160

                      12

                      0.8214

                      0.8740

                      0.8448

                      0.0388

                      R:AGAACGCTTGGAGAATCGAA

                      ZJU115ab

                      JQ318810

                      (AG)14

                      F:<FAM > <Tail-3 > GGTCTGAGGCCTTCACTCTG

                      126-156

                      14

                      0.9677

                      0.9022

                      0.8775

                      0.0068

                      R:GAGACCCAATAACCCATCCA

                      ZJU116ab

                      JQ318811

                      (AG)15

                      F:<FAM > <Tail-3 > CTTTCTCCGTCTGCTCCATC

                      110-136

                      13

                      0.6875

                      0.8199

                      0.7846

                      0.0001

                      R:GTCCAAACTTGGAGCCCATA

                      ZJU117ab

                      JQ318812

                      (AAG)9

                      F:<FAM > <Tail-3 > TCTCAGATCCCTCCACGTTC

                      118-133

                      6

                      0.4688

                      0.6944

                      0.6426

                      0.0000

                      R:CCACTGGATCAGGACAACCT

                      ZJU118ab

                      JQ318813

                      (CT)9

                      F:<FAM > <Tail-3 > CAAGCCACGTGCATACCTATT

                      120-144

                      11

                      0.8750

                      0.8502

                      0.8171

                      0.0001

                      R:CAGCTGGCTTCTAACTGCAA

                      ZJU119a

                      JQ318814

                      (AG)11

                      F:<FAM > <Tail-3 > CTTTCGACTTCAGAGGCAGC

                      136-152

                      9

                      0.4828

                      0.8348

                      0.7975

                      0.0000

                      R:TCCCTCTCAAACTTTGCCAC

                      ZJU120ab

                      JQ318815

                      (GA)8

                      F:<HEX > <Tail-4 > TTGGTTTCGTTTGCAAGTCA

                      164-180

                      6

                      0.9355

                      0.7012

                      0.6354

                      0.0073

                      R:GTCATCCATCCAATCCATCC

                      ZJU121a

                      JQ318816

                      (CT)11

                      F:<HEX > <Tail-4 > AATCACCGAAGAAATCCACG

                      164-186

                      11

                      0.8621

                      0.8705

                      0.8426

                      0.0000

                      R:ATTGCCCTCCCTTCTGTTCT

                      ZJU122ab

                      JQ318817

                      (TC)8

                      F:<HEX > <Tail-4 > TGACGGAAGGATACTGGCTC

                      164-180

                      7

                      0.7742

                      0.7509

                      0.7012

                      0.0000

                      R:CCATCAGACATGGCTTTCCT

                      ZJU123ab

                      JQ318818

                      (CT)8

                      F:<HEX > <Tail-4 > TGAATTATTCGGTTCCCTGG

                      172-176

                      3

                      0.4667

                      0.6367

                      0.5499

                      0.2152

                      R:TGCTTCAGTTCCAAACGAAA

                      ZJU124ab

                      JQ318819

                      (CT)10

                      F:<HEX > <Tail-4 > GTGGCAGCCTCTCTATCGTC

                      161-187

                      12

                      0.9355

                      0.8778

                      0.8498

                      0.0001

                      R:ATGACGTACTGCCCTTGCTT

                      ZJU125ab

                      JQ318820

                      (TC)8

                      F:<HEX > <Tail-4 > TAAGGGCAGTCAGACCAACC

                      164-186

                      4

                      0.2188

                      0.3884

                      0.3453

                      0.0000

                      R:CTGCAGCCTACAATGATCCA

                      ZJU126ab

                      JQ318821

                      (GA)10

                      F:<HEX > <Tail-4 > CCAATGTGGACAGGTGTGAG

                      173-193

                      11

                      0.9677

                      0.8535

                      0.8228

                      0.0000

                      R:GGCAGTAGTCGCTTCCCATA

                      ZJU127

                      JQ318822

                      (GC)10

                      F:<HEX > <Tail-4 > AGGATCCTTGTCACCACCAG

                      165-189

                      11

                      0.9259

                      0.8288

                      0.7900

                      0.0079

                      R:AATTCTTCCTTCCCAGCCTC

                      ZJU128ab

                      JQ318823

                      (AG)14

                      F:<HEX > <Tail-4 > CCCAATTGACACAAATTCCC

                      145-161

                      5

                      0.4194

                      0.5019

                      0.4496

                      0.1981

                      R:TTGGCATAGCATTGTTCGTC

                      ZJU129ab

                      JQ318824

                      (CT)10

                      F:<HEX > <Tail-4 > GAGGTGCAATTACGTGGCTT

                      161-189

                      10

                      0.7500

                      0.8031

                      0.7611

                      0.0234

                      R:TCAAGCATCAGCTGCTCAGT

                      ZJU130ab

                      JQ318825

                      (GA)8

                      F:<HEX > <Tail-4 > GATTGCATGCACCAAATCAC

                      160-176

                      5

                      0.3478

                      0.4599

                      0.4131

                      0.2852

                      R:GAATGTCCACGACGTGAATG

                      ZJU131ab

                      JQ318826

                      (CT)14

                      F:<HEX > <Tail-4 > TTGAGAATCACAAACGCCTG

                      153-187

                      13

                      0.8710

                      0.8990

                      0.8735

                      0.0009

                      R:GGTGGGTGAAATGCCTAGAA

                      ZJU132ab

                      JQ318827

                      (CT)11

                      F:<HEX > <Tail-4 > AGGCACCTTTCTTTCCTCTC

                      164-178

                      5

                      0.6452

                      0.6568

                      0.5834

                      0.6586

                      R:CAAGGAAGGAGGTGACGAAG

                      ZJU133ab

                      JQ318828

                      (TC)11

                      F:<HEX > <Tail-4 > GCCCTGCAGTCTTTGTCAAT

                      171-195

                      8

                      0.8710

                      0.7731

                      0.7267

                      0.0000

                      R:CAGCTTGCAGTGTTCATTCA

                      ZJU134ab

                      JQ318829

                      (GA)11

                      F:<HEX > <Tail-4 > AGTGCCCAAGCATGACTTCT

                      172-190

                      8

                      0.9688

                      0.7907

                      0.7507

                      0.0004

                      R:AATCAGTTGTCCGAGGATGG

                      ZJU135ab

                      JQ318830

                      (AG)10

                      F:<HEX > <Tail-4 > AATTTACGGCTGTCCGTGAG

                      173-191

                      10

                      0.9688

                      0.7966

                      0.7557

                      0.0000

                      R:CCTTGGGCTTCATGAACATT

                      ZJU136ab

                      JQ318831

                      (GA)10

                      F:<HEX > <Tail-4 > TCCCACAGATCTCTAGCCGT

                      173-201

                      13

                      0.7742

                      0.8953

                      0.8692

                      0.0004

                      R:CGCTCAGTTCTTAATTTCTTACTGTC

                      ZJU137ab

                      JQ318832

                      (TC)8

                      F:<HEX > <Tail-4 > TGGATCTTGCTGCAGTTGTC

                      140-168

                      12

                      0.1875

                      0.6930

                      0.6612

                      0.0000

                      R:AGCTAGCACTGGCCTAACCA

                      ZJU138ab

                      JQ318833

                      (CT)10

                      F:<HEX > <Tail-4 > GCACAGTTGAGTTATGGGCA

                      152-170

                      8

                      0.3333

                      0.7746

                      0.7261

                      0.0001

                      R:CTCTTTCAAATCCACGCACA

                      ZJU139ab

                      JQ318834

                      (GA)12

                      F:<HEX > <Tail-4 > CCGAGCTTCGTTAGGACTTG

                      138-164

                      6

                      0.3667

                      0.4418

                      0.4043

                      0.0000

                      R:CCAACAATACCCGAACCATC

                      ZJU140b

                      JQ318835

                      (CT)14

                      F:<HEX > <Tail-4 > TGTGCTCATCTTGGATCCTG

                      172-198

                      9

                      0.6538

                      0.6139

                      0.5474

                      0.0000

                      R:ACATCAGCTTGCATCCCTCT

                      ZJU141ab

                      JQ318836

                      (CT)13

                      F:<HEX > <Tail-4 > CACAATCAGCTGCAGAATCAA

                      175-201

                      11

                      0.6774

                      0.7996

                      0.7600

                      0.0002

                      R:AATGGCCGCTTGCAATATAA

                      ZJU142ab

                      JQ318837

                      (TC)13

                      F:<HEX > <Tail-4 > CATTCACCTCCTTTCGCAAT

                      166-184

                      9

                      0.6774

                      0.6912

                      0.6498

                      0.0231

                      R:ATCCAACGGCTCAAAGAATG

                      ZJU143ab

                      JQ318838

                      (CT)12

                      F:<HEX > <Tail-4 > GTAGAGTAGATGCGCCTCGG

                      181-197

                      7

                      0.6923

                      0.7044

                      0.6397

                      0.0000

                      R:ACGTACGAGCCATACACACG

                      ZJU144ab

                      JQ318839

                      (AG)12

                      F:<HEX > <Tail-4 > GCCACTCTTCCCTCAACGTA

                      148-164

                      7

                      0.5161

                      0.6864

                      0.6252

                      0.0430

                      R:CAGGTCAGTCCTGATGGGAT

                      ZJU145ab

                      JQ318840

                      (CT)10

                      F:<HEX > <Tail-4 > TGTGGCTGTGTTCCTCCATA

                      155-175

                      7

                      0.6875

                      0.7351

                      0.6912

                      0.0000

                      R:CAATGTTGGGTGCTTTGTTG

                      ZJU146ab

                      JQ318841

                      (AG)10

                      F:<HEX > <Tail-4 > TGGAAACTTTGTCGTGTGGA

                      154-168

                      6

                      0.2258

                      0.6663

                      0.6187

                      0.0000

                      R:TTATATCGGGCAGCCAGAAC

                      ZJU147ab

                      JQ318842

                      (AG)10

                      F:<HEX > <Tail-4 > TTAGGAACCAAACTGGACGG

                      173-195

                      10

                      0.8333

                      0.7169

                      0.6811

                      0.0005

                      R:TCAAATGCCGTGCTATTGAG

                      ZJU148ab

                      JQ318843

                      (AG)18

                      F:<HEX > <Tail-4 > AAGAGCAGGAACCGAACCTT

                      160-190

                      15

                      0.9375

                      0.9067

                      0.8829

                      0.4973

                      R:ACCGAAAGACGAAGAAACGA

                      ZJU149ab

                      JQ318844

                      (TC)8

                      F:<HEX > <Tail-4 > AGCCCTCCATGTGTGCTTAT

                      139-163

                      11

                      0.8333

                      0.8718

                      0.8417

                      0.0022

                      R:AGGGAGAGAGTGGTTCTGCC

                      ZJU150ab

                      JQ318845

                      (AG)10

                      F:<HEX > <Tail-4 > ACTTAACTGAGAGGCTGCGG

                      163-201

                      10

                      0.9000

                      0.8469

                      0.8123

                      0.0053

                      R:GTGGAAACCGAACGTCCTAA

                      ZJU151ab

                      JQ318846

                      (CA)9

                      F:<HEX > <Tail-4 > GAATTGGAAATCCCTAGCCC

                      156-170

                      6

                      0.3750

                      0.5511

                      0.5188

                      0.0001

                      R:CATTTGCGCATGTCTCCTTA

                      ZJU152ab

                      JQ318847

                      (AG)11

                      F:<HEX > <Tail-4 > AAACGAAGTCGTTCAATGCC

                      163-181

                      7

                      0.9355

                      0.7578

                      0.7040

                      0.0161

                      R:CTTGATTTGGGCCTTCGATA

                      ZJU153ab

                      JQ318848

                      (AG)10

                      F:<HEX > <Tail-4 > CCAGCTCCGAATTAGCAAAC

                      173-191

                      6

                      1.0000

                      0.6667

                      0.5927

                      0.0000

                      R:GTGGCGGTTTATCTCATCGT

                      ZJU154ab

                      JQ318849

                      (AG)11

                      F:<HEX > <Tail-4 > TTGTCAATTGCCCTTCCTTC

                      156-184

                      10

                      0.9333

                      0.6847

                      0.6184

                      0.0000

                      R:TTCCTCCCTTTCCCACTTCT

                      ZJU155ab

                      JQ318850

                      (TC)9

                      F:<HEX > <Tail-4 > GAGAGCAATCAGTGAAGCCC

                      160-188

                      8

                      0.8438

                      0.6731

                      0.6037

                      0.0000

                      R:GGGAGACGGATGTCGATTTA

                      ZJU156ab

                      JQ318851

                      (TA)8

                      F:<HEX > <Tail-4 > ATACGTCGAAAGATCCACCG

                      166-184

                      7

                      0.5484

                      0.6626

                      0.6063

                      0.0000

                      R:TTCTGGAATCCTTCCCATTG

                      ZJU157ab

                      JQ318852

                      (AG)9

                      F:<HEX > <Tail-4 > CACTCACAACCAAAGCCAGA

                      154-186

                      13

                      0.9677

                      0.9064

                      0.8823

                      0.0171

                      R:GTGCATAATCACAGGCATGA

                      ZJU158ab

                      JQ318853

                      (AT)10

                      F:<HEX > <Tail-4 > CCAGATGATCACGCAGCTTA

                      156-174

                      9

                      0.6452

                      0.8292

                      0.7917

                      0.0000

                      R:CGTCCTCCAATACGTTCCTC

                      Mean

                      8.25

                      0.5636

                      0.7178

                      0.6730

                       

                      Note: a b c These SSRs are transferable for M. adenophora, M. nana and M. cerifera, respectively. SSR markers are listed according to ascending order in different fluorescent dyes. Shown for each primer pair are the repeat motif, primer sequences, size range (bp), number of alleles detected (Na), observed heterozygosity (Ho), expected heterozygosity (He), polymorphism information content (PIC) and Chi-square test for Hardy-Weinberg equilibrium (P HW). The annealing temperature was 60 °C; a, including length of tail sequences (18 bp total). P HW over 0.05 are underlined.

                      The PIC at each locus ranged from 0.256 to 0.883 with an average of 0.67 loci. The PCR product size ranged from 110 to 274 bp. All the primers produced amplicons in agreement with the expected sizes. Most of the SSR primers (139 primer pairs) showed significant deviation from HW equilibrium (P < 0.05). Partial correlation analysis showed that significant positive correlations existed between the repeat unit length and PIC (P < 0.01, r = 0.2747). This showed that these SSRs had high rates of transferability for M. adenophora (91.14%) and M. nana (89.87%) and low rates for M. cerifera (46.84%), indicating that these markers are suitable for genetic diversity analyses in other Myrica species.

                      One of the objectives of this study was to develop potential suitable SSR markers for genetic mapping using Biqi and Dongkui as crossing parents. We selected 99 heterozygous loci in Biqi and 105 in Dongkui (Table 3): 135 primer pairs can be used together in linkage mapping of the planned F1 populations between Biqi and Dongkui.
                      Table 3

                      Distribution of the segregation types expected for the mapping population (Biqi × Dongkui)

                      Segregation type

                      Alleles

                      Number

                      Mapping in F1

                      aa × aa

                      1

                      12

                      No

                      aa × bb

                      2

                      11

                      No

                      aa × ab

                      2

                      24

                      Yes

                      ab × aa

                      2

                      18

                      Yes

                      ab × ab

                      2

                      8

                      Yes

                      aa × bc

                      3

                      12

                      Yes

                      ab × cc

                      3

                      12

                      Yes

                      ab × ac

                      3

                      41

                      Yes

                      ab × cd

                      4

                      20

                      Yes

                      Total

                      135

                       

                      Genetic relationship analysis

                      The 32 accessions were divided into three groups (A, B and C, Figure 4), based on Nei’s genetic distance coefficient [16] using UPGMA cluster analysis. The similarity among all the accessions varied from 0.54 to 0.84. At the species level, the UPGMA dendrogram produced clusters separating M. nana and M. cerifera into two distinct groups. The genetic similarity between M. cerifera and M. rubra was 0.54, lower than the 0.74 previously reported by Xie [6].
                      http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-13-201/MediaObjects/12864_2012_4370_Fig4_HTML.jpg
                      Figure 4

                      Dendrogram for 32 Chinese bayberry accessions derived from UPGMA cluster analysis based on 158 SSR markers. The symbols before the accession codes indicate the sex: ○, androphyte plant, ●, common cultivars, and ◘, monoecious plant. The numbers are bootstrap values based on 1000 iterations. Only bootstrap values larger than 50 are indicated.

                      The main cluster ‘A’ included the subgroups A-1 and A-2. Subgroup A-1 includes 16 accessions, mainly from the cities of Ningbo (12) and Hangzhou (3), where the popular and dominant cultivar is Biqi. This demonstrates that these natural elite seedling selections are truly distinct from the local cultivars. For their genetic relationships (Figure 4), the rare monoecious individual (C2010-4) is closely related to Biqi, while the accessions ‘Shuijing’ and ‘Y2010-72’ (both white fruit type) are clearly separated in the cluster, with low genetic distance.

                      Subgroup A-2 includes 14 accessions, with four from Wenzhou, two from Taizhou, and one each from the cities of Hangzhou and Ningbo, and the Hunan, Guangxi, Guizhou and Jiangsu provinces. This group includes the popular cultivar Dongkui. The four accessions from Wenzhou distributed in this cluster have genetic similarity. The accession ‘Tongzimei’ from the Hunan province is on an independent branch, showing that it is genetically distinct. ‘Xiaolejiangchonghei’ and ‘M. adenophora’ grouped together, and are possibly in the same population. Six androphyte accessions, distributed in group A, are close to cultivars of the same geographic origin.

                      The accessions ‘Myrica nana’ from Yunnan and ‘Myrica cerifera’ from the USA were independently classified as the ‘B’ and ‘C’ group, indicating a distant relationship with cultivated Myrica rubra.

                      Discussion

                      Our major aims were to find a large set of SSR markers for Myrica rubra and understand the genetic diversity and relationship among representative cultivars, androphyate and related species. This research paves the way for constructing an SSR-based linkage map in Myrica.

                      The genome characteristics of genus Myrica

                      Shotgun sequencing is suitable for simple genomes, with no or few repeat sequences, such as Chinese bayberry. For such genomes, the genome can largely be assembled simply by merging together reads containing overlapping sequence [17]. We report the genome survey of Chinese bayberry using whole genome shotgun sequencing. The 17-nucleotide depth distribution suggests a genome size of 323 Mb, larger than peach (220 Mb, http://​www.​rosaceae.​org/​peach/​genome), but close to our estimate of 250 Mb from flow cytometry using rice as the reference (date not shown). Although the highly homozygous material was selected on a limited number of SSR loci assays, the actual heterozygous rate, as revealed by 185 new SSR markers, was very high (63%). To overcome the key issue of heterozygosity and allow us to generate a high-quality genome sequence, we can use a unique homozygous form such as monoploid, derived using tissue culture or from nature and worth further study.

                      Marker development for under-utilised fruit crops

                      SSRs have been widely used for high-throughput genotyping and map construction as they have the advantage of high abundance, random distribution within the genome, high polymorphism information content and stable co-dominance [1820]. They can be developed from either genomic or expressed sequence tag (EST) libraries. Although EST-SSRs are useful for genetic analysis, their disadvantages of relatively low polymorphism and high concentration in gene-rich regions of the genome may limit their usage, especially for the construction of linkage maps [21]. In this study, a total of 600 SSR primer pairs were designed from 28,602 SSR sites, and 581 (96.8%) primer pairs were effective. Due to the self-complementary nature to form dimers, AT/TA is not usually used to develop markers [12]. Our findings are in agreement with that published for peach, where the dinucleotide repeat motifs were also found to be the most common, and (CT)n as the most common repeat unit [22].

                      In the present study, the mean value of PIC was higher than the previously reported 0.62 [7], but the consistent relationship was observed between SSR polymorphism and repeat unit length. There are some reports of a positive relationship between degree of polymorphism and repeat unit length [23, 24]. However, those polymorphic SSRs that are homozygous in both parents cannot be mapped in F1 populations, although they are useful for mapping in F2 or backcross populations [25], while heterozygous SSRs can be used for mapping in F1 populations (Table 2). The estimated number of SSRs that can be mapped in the F1 populations between Biqi and Dongkui was about 85%.

                      Recently, based on mass sequence data of Chinese bayberry obtained by RNA-Seq, 41,239 UniGenes were identified and approximately 80% of the UniGenes (32,805) were annotated, which provides an excellent platform for future EST-SSR development and functional genomic research [26].

                      High efficient test methods

                      Normally, a universal M13 primer is labelled with one of a number of fluorescent dyes. The tailed primer provides a complementary sequence to the fluorescent labelled M13 primer, leading to the amplification of fluorescent PCR products, and then the PCR products of different sizes and/or labelled with different fluorescent dyes are mixed and tested [27]. In this research, a multiplex PCR strategy was designed using the universal M13-tailed primer and three additional tail primers, designed arbitrarily, in presumed four-plex amplifications in single PCR, for a major reduction in cost and time. However, as only a few primer combinations were successful, most resulting in weak bands, we did the PCR individually and mixed the PCR products. Further optimisation of multiplex PCR is needed to evaluate its general applicability.

                      Evolution ofMyricaspecies

                      In this study, both cultivated species and wild species were analysed and their genetic diversity could easily be differentiated. M. nana and M. cerifera were clearly genetically distant to M. rubra. M. nana, also known as the dwarf or Yunnan arbutus, is indigenous to the Yunnan and Guizhou provinces, and has a plant height of < 2 m. The juvenile period of fruit tree can be shortened for breeding purposes. Studies on embryo culture in vitro of the F1 seeds of crosses between M. rubra and M. nana, [28], has shown good cross compatibility between M. rubra and M. nana, resulting in 70.5% normal seeds with intact embryo. M. adenophora and M. nana grow as wild trees, with the fruit of M. adenophora only suitable for medical purposes and not edible.

                      Our findings on the genetic similarity between M. adenophora and M. rubra, which are considered a progenitor-derivative species pair, are consistent with a previously published figure of 0.897 [29]. An earlier study observed little change in allelic diversity along the chronosequence and no evidence for heterosis, although there was a moderate change in genotypic diversity [30]. The markers developed in this study can be very useful in future population structure analysis.

                      Conclusions

                      In summary, the genome size of Myrica genus is small, about 320 Mb. A large set of SSRs were developed from a genome survey of Myrica rubra. The results suggest that they have high rates of transferability, making them suitable for use in other Myrica species.

                      Materials and methods

                      Plant materials and genome survey

                      We selected an androphyte ‘C2010-55’ for the genome survey because it was the most homozygous (10 out of 14 SSRs) individual among 230 accessions. Two DNA libraries of 250 and 500 bp insert size were constructed and sequenced by Illumina Hi-Seq 2000.

                      Twenty-nine accessions of the cultivated species (M. rubra) and 3 related species (M. adenophora, M. nana, M. cerifera), collected from different provinces in China (Table 4), were used to evaluate the suitability of the SSRs for genetic distance analysis. Young leaves were collected and frozen in liquid nitrogen prior to genomic DNA extraction using CTAB methods [4]. DNA concentrations were measured spectrophotometrically at 260 nm, and the extracts electrophoresed on 1% agarose to confirm the quality. The purified DNAs were standardised at 40 ng/μl and stored at -40°C.
                      Table 4

                      The 32 bayberry accessions included in this study

                      No.

                      Accession

                      Fruit/Flower coloura

                      Fruit maturity date

                      Region

                      1

                      Biqi

                      black

                      Late June

                      Cixi, Ningbo, Zhejiang

                      2

                      Dongkui

                      red

                      Early July

                      Taizhou, Zhejiang

                      3

                      Dayehuang

                      red

                      Mid-June

                      Hangzhou, Zhejiang

                      4

                      Dingaomei

                      black

                      Mid to late June

                      Wenzhou, Zhejiang

                      5

                      Huangshanbai

                      white

                      Early July

                      Hangzhou, Zhejiang

                      6

                      Jiazhaizao

                      black

                      Mid-June

                      Wenzhou, Zhejiang

                      7

                      Jianmei

                      red

                      Late June

                      Cixi, Ningbo, Zhejiang

                      8

                      Muyemei

                      black

                      Late June

                      Jinhua, Zhejiang

                      9

                      Putaoli

                      black

                      Mid June

                      Hangzhou, Zhejiang

                      10

                      Shuijing

                      white

                      Late June/Early July

                      Yuyao, Ningbo, Zhejiang

                      11

                      Tongzimei

                      black

                      Mid-June

                      Hunan

                      12

                      Wandao

                      black

                      Early July

                      Zhoushan, Zhejiang

                      13

                      Xiaolejiangchonghei

                      black

                      May

                      Guizhou

                      14

                      Biqi12

                      black

                      Late June

                      Yuyao, Ningbo, Zhejiang

                      15

                      Y2010-70

                      red

                      Late June/Early July

                      Yuyao, Ningbo, Zhejiang

                      16

                      Y2010-71

                      black

                      Mid to late June

                      Yuyao, Ningbo, Zhejiang

                      17

                      Y2010-72

                      white

                      Late June/Early July

                      Yuyao, Ningbo, Zhejiang

                      18

                      Y2010-73

                      red

                      Late June

                      Yuyao, Ningbo, Zhejiang

                      19

                      Y2010-74

                      red

                      Late June/Early July

                      Yuyao, Ningbo, Zhejiang

                      20

                      Y2010-75

                      black

                      Late June

                      Yuyao, Ningbo, Zhejiang

                      21

                      Y2010-76

                      white

                      Late June/Early July

                      Yuyao, Ningbo, Zhejiang

                      22

                      Y2010-77

                      red

                      Late June/Early July

                      Yuyao, Ningbo, Zhejiang

                      23

                      C2010-4

                      red

                      Late June

                      Cixi, Ningbo, Zhejiang

                      24

                      *C2010-55

                      red

                      -

                      Cixi, Ningbo, Zhejiang

                      25

                      *W2011-1

                      yellow- red

                      -

                      Wenzhou, Zhejiang

                      26

                      *W2011-5

                      red

                      -

                      Wenzhou, Zhejiang

                      27

                      *H2011-12

                      yellow-green

                      -

                      Hangzhou, Zhejiang

                      28

                      *JS2011-16

                      red

                      -

                      Suzhou, Jiangsu

                      29

                      *T2011-30

                      red

                      -

                      Taizhou, Zhejiang

                      30

                      Myrica adenophora

                      red

                      February to May

                      Guilin, Guangxi

                      31

                      Myrica nana

                      red

                      June to July

                      Yunnan

                      32

                      *Myrica cerifera

                      yellow-green

                      -

                      Cixi, Ningbo, Zhejiang

                      Note: fruit colour for cultivar and flower colour for androphyte. * selected androphytes.

                      SSR identification and primer design

                      We used MISA scripting language ( http://​pgrc.​ipk-gatersleben.​de/​misa/​misa.​html) to identify microsatellite repeats in our sequence database. The SSR loci containing perfect repeat units of 2-6 nucleotides only were considered. The minimum SSR length criteria were defined as six reiterations for dinucleotide, and five reiterations for other repeat units. Mononucleotide repeats and complex SSR types were excluded from the study.

                      The SSR primers were designed using BatchPrimer3 interface modules ( http://​pgrc.​ipk-gatersleben.​de/​misa/​primer3.​html). We selected 600 primers that met the following parameters: 110–230 final product length, primer size from 18 to 22 bp with an optimum size of 20 bp, and the annealing temperature was set at 60°C. The repeat units over eight were used.

                      Tail-1(M13 universal sequence-TGTAAAACGACGGCCAGT), Tail-2(CGAGTCAGTATAGGGCAC), Tail-3(ATCACGAAGCAGATGCAA) and Tail-4(GAGCATCTCGTACCAGTC) were added to the 5’ end of each 150 forward primers of pairs respectively. Tail-2, Tail-3 and Tail-4 were designed so that the primer size was 18 bp and the annealing temperature was 53°C. Primers were synthesised by Invitrogen Trading (Shanghai) Co., Ltd. We primarily tested two cultivars (Biqi and Dongkui) and M. cerifera for 600 SSR loci by PAGE (polyacrylamide denaturing gel) to confirm their suitability. Tail-1, Tail-2, Tail-3 and Tail-4 labelled with one of the following dyes: NED, PET, FAM, and HEX, respectively.

                      Polymerase chain reaction and gel electrophoresis

                      Each 20 μl reaction mixture contained 10 × PCR buffer (plus Mg2+), 0.2 mM of each dNTP, 5 pmol of each reverse, 4 pmol of the tail primer, 1 pmol of the forward primer, 0.5 units of rTaq polymerase (TaKaRa, China) and 40 ng genomic DNA template. Each primer pair had an interval of 20 bp according to the expected size of amplicons.

                      DNA amplification was in an Eppendorf Mastercycler (Germany) programmed at 94°C for 5 min for initial denaturation, then 32 cycles at 94°C (30 s)/58°C (30 s)/72°C (30 s), followed by 8 cycles of 94°C (30 s)/53°C (30 s)/72°C (30 s). The final extension step was 10 min at 72°C. Each PCR product was run on 1% agarose gel at 110 V for a quality check.

                      Subsequently, PCR products were electrophoresed on 8% denaturing PAGE, according to Myers et al. [31], at 60 W in a Sequi-Gen GT Nucleic Acid electrophoresis cell (BioRad) for 4 h, depending on the fragment sizes to be separated, and visualised by silver staining [32]. Genotypes showing one and two bands were scored as homozygous and heterozygous, respectively, and the results recorded and photographed.

                      Multiplex PCR was designed and tested with products of different sizes and labelled with different fluorescent dyes. Each 20 μl reaction mixture contained 10 × PCR buffer (plus Mg2+), 0.8 mM of each dNTP, 1 unit of rTaq polymerase, 40 ng genomic DNA template and a total of four primer pairs with 5 pmol of each reverse primer, 4 pmol of each tail primer, and 1 pmol of each forward primer. The PCR products were diluted, mixed with the internal size standard LIZ500 (Applied Biosystems) and loaded on an ABI 3130 Genetic Analyzer. Alleles were scored using GeneMapper version 4.0 software (Applied Biosystems, Foster City, CA, USA).

                      Data analysis

                      The raw genome sequence data was first filtered to obtain high quality reads, then assembled using SOAP ( http://​soap.​genomics.​org.​cn/​soapdenovo.​html) denovo software to contig, scaffold and fill in gaps. In addition, we used SSPACE software to build the scaffold. K-mer analysis was to help estimate the genome size and characters, such as heterozygosis and repeats.

                      The number of alleles (A), observed heterozygosity (Ho) and expected heterozygosity (He) were calculated using POPGENE version 1.32 ( http://​www.​ualberta.​ca/​~fyeh/​popgene_​download.​html). Chi-square test for Hardy-Weinberg equilibrium allele frequencies and polymorphism information content (PIC) was calculated using PowerMarker version 3.25 [33] ( http://​statgen.​ncsu.​edu/​powermarker/​downloads.​htm). Microsoft office Excel 2007 was used to analyse the correlation. Genetic similarity among all the accessions was calculated according to Dice’s coefficients using Nei's coefficient index [16] with the Free Tree 0.9.1.50 [34] ( http://​www.​natur.​cuni.​cz/​~flegr/​programs/​freetree.​htm) software, and the dendrogram constructed using the unweighted pair-group method with arithmetic averaging (UPGMA) option. The confidence of branch support was then evaluated by bootstrap analysis with 1,000 replicates. The dendrogram was printed using MEGA version 5.05 software [35] ( http://​www.​megasoftware.​net/​mega.​php).

                      Declarations

                      Acknowledgements

                      This work was supported by grants from the Zhejiang Province (2006 C14016) and Special Research Fund for International Cooperation with European Union (1114) and Public Welfare in Chinese Agriculture (contract no. 200903044) We thank Dr Rangjin Xie for technical assistance in the PAGE experiment, and Dr. Shirley Burgess for correcting the English.

                      Author details

                      1Department of Horticulture, The State Agriculture Ministry Laboratory of Horticultural Plant Growth, Development and Quality Improvement, Zhejiang University, Hangzhou 310058, China. 2BGI-Shenzhen, Beishan Industrial Zone, Yantian District, Shenzhen 518083, China. 3Fruit Research Institute, Yuyao, Ningbo 315400, China. 4Forestry Technology Extension Center, Cixi Ningbo 315300, China. 5Plant Breeding-Wageningen University and Research Centre, P.O. Box 166700 AA, Wageningen, The Netherlands.

                      Authors’ Affiliations

                      (1)
                      Department of Horticulture, The State Agriculture Ministry Laboratory of Horticultural Plant Growth, Development and Quality Improvement, Zhejiang University
                      (2)
                      BGI-Shenzhen, Beishan Industrial Zone
                      (3)
                      Fruit Research Institute
                      (4)
                      Forestry Technology Extension Center
                      (5)
                      Plant Breeding-Wageningen University and Research Centre

                      References

                      1. Chen K, Xu C, Zhang B, Ferguson IB: Red bayberry: botany and horticulture, in Horticultural Reviews. Edited by: Jules Janick. John Wiley & Sons, Inc, Oxford; 2004:83–114. 30
                      2. Zhang B, Kang MX, Xie QP, Xu B, Sun CD, Chen KS, Wu YL: Anthocyanins from Chinese bayberry extract protect beta cells from oxidative stress-mediated injury via HO-1 upregulation. J Agr Food Chem 2011,59(2):537–545.View Article
                      3. Terakawa M, Kikuchi S, Kanetani S, Matsui K, Yumoto T, Yoshimaru H: Characterization of 13 polymorphic microsatellite loci for an evergreen tree, Myrica rubra. Mol Ecol Notes 2006,6(3):709–711.View Article
                      4. Zhang SM, Xu CJ, Gao ZS, Chen KS, Wang GY: Development and characterization of microsatellite markers for Chinese bayberry (Myrica rubra Sieb. & Zucc.). Conserv Genet 2009,10(5):1605–1607.View Article
                      5. Xie XB, Qiu YY, Ke LP, Zheng XL, Wu GT, Chen JQ, Qi XJ, Ahn S: Microsatellite primers in red bayberry, myrica rubra (Myricaceae). Am J Bot 2011,98(4):E93-E95.PubMedView Article
                      6. Xie R-J, Zhou J, Wang G-Y, Zhang S-M, Chen L, Gao Z-S: Cultivar identification and genetic diversity of chinese bayberry (Myrica rubra) accessions based on fluorescent SSR markers. Plant Mol Biol Rep 2011,29(3):554–562.View Article
                      7. Zhang SM, Gao ZS, Xu CJ, Chen KS: Genetic diversity of Chinese bayberry (Myrica rubra Sieb. et Zucc.) accessions revealed by Amplified Fragment Length Polymorphism. HortSci 2009,44(2):487–491.
                      8. Cheng YJ, Zhang R, Zhu AD, Wang XJ, Yu J, Zhang HR, Gao JS, Deng XX: Development of Juglans regia SSR Markers by data mining of the EST database. Plant Mol Biol Rep 2010,28(4):646–653.View Article
                      9. Aravanopoulos FA, Ganopoulos IV, Avramidou E, Fasoula DA, Diamantidis G: Assessing inter- and intra-cultivar variation in Greek Prunus avium by SSR markers. Plant Genet Resour-C 2010,8(3):242–248.View Article
                      10. Audergon JM, Bourguiba H, Khadari B, Krichen L, Trifi-Farah N, Santoni S: Grafting versus seed propagated apricot populations: two main gene pools in Tunisia evidenced by SSR markers and model-based Bayesian clustering. Genetica 2010,138(9–10):1023–1032.PubMed
                      11. Baudouin L, Martinez RT, Berger A, Dollet M: Characterization of the genetic diversity of the Tall coconut (Cocos nucifera L.) in the Dominican Republic using microsatellite (SSR) markers. Tree Genet Genomes 2010,6(1):73–81.View Article
                      12. Wu YQ, Wang YW, Samuels TD: Development of 1,030 genomic SSR markers in switchgrass. Theor Appl Genet 2011,122(4):677–686.PubMedView Article
                      13. Goff SA: A draft sequence of the rice genome (Oryza sativa L. ssp. japonica) (April, pg 92, 2002). Science 2005,309(5736):879–879.
                      14. Wang J, Chen C, Na J-K, Yu Q, Hou S, Paull R, Moore P, Alam M, Ming R: Genome-wide comparative analyses of microsatellites in papaya. Tropical Plant Biology 2008,1(3):278–292.View Article
                      15. Schuelke M: An economic method for the fluorescent labeling of PCR fragments. Nat Biotechnol 2000,18(2):233–234.PubMedView Article
                      16. Nei M: Genetic Distance between Populations. Am Nat 1972,106(949):283–292.View Article
                      17. Batzoglou S, Jaffe DB, Stanley K, Butler J, Gnerre S, Mauceli E, Berger B, Mesirov JP, Lander ES: ARACHNE: A whole-genome shotgun assembler. Genome Res 2002,12(1):177–189.PubMedView Article
                      18. Watanabe KN, Hirano R, Ishii H, Oo TH, Gilani SA, Kikuchi A: Propagation management methods have altered the genetic variability of two traditional mango varieties in Myanmar, as revealed by SSR. Plant Genet Resour-C 2011,9(3):404–410.View Article
                      19. Chen C, Zhou P, Choi Y, Huang S, Gmitter F: Mining and characterizing microsatellites from citrus ESTs. Theor Appl Genet 2006,112(7):1248–1257.PubMedView Article
                      20. Fraser LG, Harvey CF, Crowhurst RN, De Silva HN: EST-derived microsatellites from Actinidia species and their potential for mapping. Theor Appl Genet 2004,108(6):1010–1016.PubMedView Article
                      21. McCouch SR, Cho YG, Ishii T, Temnykh S, Chen X, Lipovich L, Park WD, Ayres N, Cartinhour S: Diversity of microsatellites derived from genomic libraries and GenBank sequences in rice (Oryza sativa L.). Theor Appl Genet 2000,100(5):713–722.View Article
                      22. Sosinski B, Gannavarapu M, Hager LD, Beck LE, King GJ, Ryder CD, Rajapakse S, Baird WV, Ballard RE, Abbott AG: Characterization of microsatellite markers in peach [Prunus persica (L.) Batsch]. Theor Appl Genet 2000,101(3):421–428.View Article
                      23. Cuc LM, Mace ES, Crouch JH, Quang VD, Long TD, Varshney RK: Isolation and characterization of novel microsatellite markers and their application for diversity assessment in cultivated groundnut (Arachis hypogaea). BMC Plant Biol 2008., 8:
                      24. Kapila RK, Yadav RS, Plaha P, Rai KN, Yadav OP, Hash CT, Howarth CJ: Genetic diversity among pearl millet maintainers using microsatellite markers. Plant Breeding 2008,127(1):33–37.
                      25. Lu J, Huang H, Ren ZB, Hunter W, Dowd SE, Dang P: Mining and validating grape (Vitis L.) ESTs to develop EST-SSR markers for genotyping and mapping. Mol Breeding 2011,28(2):241–254.View Article
                      26. Feng C, Chen M, Xu CJ, Bai L, Yin XR, Li X, Allan AC, Ferguson IB, Chen KS: Transcriptomic analysis of Chinese bayberry (Myrica rubra) fruit development and ripening using RNA-Seq. BMC Genomics 2012,13(1):19.PubMedView Article
                      27. Han Y, Zheng D, Vimolmangkang S, Khan MA, Beever JE, Korban SS: Integration of physical and genetic maps in apple confirms whole-genome and segmental duplications in the apple genome. J Exp Bot 2011,62(14):5117–5130.PubMedView Article
                      28. Xie XB, Qiu YY, Zheng XL, Qi XJ, Qiu LJ, Huang ZP, Wang T, Liang SM: Studies on the crossing between Myrica rubra and M. nana and embryo culture in vitro of hybrid F1. Journal of Fruit Science 2009,26(4):507–510.
                      29. Cheng YP, Chien CT, Lin TP: Population genetics of geographically restricted and widespread species of Myrica (Myricaceae). J Hered 2000,91(1):61–66.PubMedView Article
                      30. Erickson DL, Hamrick JL: Genetic and clonal diversity for Myrica cerifera along a spatiotemporal island chronosequence. Heredity 2003,90(1):25–32.PubMedView Article
                      31. Myers RM, Maniatis T, Lerman LS: Detection and localization of single base changes by denaturing gradient gel-electrophoresis. Method Enzymol 1987, 155:501–527.View Article
                      32. Bassam BJ, Caetanoanolles G: Silver staining of DNA in polyacrylamide gels. Appl Biochem Biotech 1993,42(2–3):181–188.View Article
                      33. Liu KJ, Muse SV: PowerMarker: an integrated analysis environment for genetic marker analysis. Bioinformatics 2005,21(9):2128–2129.PubMedView Article
                      34. Hampl V, Pavlicek A, Flegr J: Construction and bootstrap analysis of DNA fingerprinting-based phylogenetic trees with the freeware program FreeTree: application to trichomonad parasites. Int J Syst Evol Micr 2001, 51:731–735.View Article
                      35. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S: MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol 2011,28(10):2731–2739.PubMedView Article

                      Copyright

                      © Jiao et al.; licensee BioMed Central Ltd. 2012

                      This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License ( http://​creativecommons.​org/​licenses/​by/​2.​0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.