High-throughput sequencing of small RNAs and analysis of differentially expressed microRNAs associated with pistil development in Japanese apricot

  • Zhihong Gao1Email author,

    Affiliated with

    • Ting Shi1Email author,

      Affiliated with

      • Xiaoyan Luo1,

        Affiliated with

        • Zhen Zhang1,

          Affiliated with

          • Weibing Zhuang1 and

            Affiliated with

            • Liangju Wang1

              Affiliated with

              BMC Genomics201213:371

              DOI: 10.1186/1471-2164-13-371

              Received: 21 November 2011

              Accepted: 25 July 2012

              Published: 3 August 2012

              Abstract

              Background

              MicroRNAs (miRNAs) are a class of endogenous, small, non-coding RNAs that regulate gene expression by mediating gene silencing at transcriptional and post-transcriptional levels in high plants. However, the diversity of miRNAs and their roles in floral development in Japanese apricot (Prunus mume Sieb. et Zucc) remains largely unexplored. Imperfect flowers with pistil abortion seriously decrease production yields. To understand the role of miRNAs in pistil development, pistil development-related miRNAs were identified by Solexa sequencing in Japanese apricot.

              Results

              Solexa sequencing was used to identify and quantitatively profile small RNAs from perfect and imperfect flower buds of Japanese apricot. A total of 22,561,972 and 24,952,690 reads were sequenced from two small RNA libraries constructed from perfect and imperfect flower buds, respectively. Sixty-one known miRNAs, belonging to 24 families, were identified. Comparative profiling revealed that seven known miRNAs exhibited significant differential expression between perfect and imperfect flower buds. A total of 61 potentially novel miRNAs/new members of known miRNA families were also identified by the presence of mature miRNAs and corresponding miRNA*s in the sRNA libraries. Comparative analysis showed that six potentially novel miRNAs were differentially expressed between perfect and imperfect flower buds. Target predictions of the 13 differentially expressed miRNAs resulted in 212 target genes. Gene ontology (GO) annotation revealed that high-ranking miRNA target genes are those implicated in the developmental process, the regulation of transcription and response to stress.

              Conclusions

              This study represents the first comparative identification of miRNAomes between perfect and imperfect Japanese apricot flowers. Seven known miRNAs and six potentially novel miRNAs associated with pistil development were identified, using high-throughput sequencing of small RNAs. The findings, both computationally and experimentally, provide valuable information for further functional characterisation of miRNAs associated with pistil development in plants.

              Keywords

              Japanese apricot microRNA Pistil abortion qRT-PCR Solexa sequencing

              Background

              Japanese apricot (Prunus mume Sieb. et Zucc) is an important economic fruit crop in China and Japan, with more than 200 cultivars in China [1]. Japanese apricot fruit has consistently been one of the most valuable processing materials used in the food and wine-making industries and is believed to contain many physiochemicals beneficial to human health. However, the phenomenon of imperfect flowers is common and seriously affects production yields. The percentage of imperfect flowers depends on the cultivar; the highest is 75.15% and the average is 35% [2]. Imperfect flowers are characterised by pistils below the stamens, withered pistils or the absence of pistils, and hence, they fail to bear fruit [3]. Several environmental factors and physiological processes have been shown to affect pistil development [1, 4]. Previous research indicated that several miRNAs and multiple target genes are involved in flower development in model plants [512]. More recently, real-time quantitative reverse transcription polymerase chain reaction and in situ hybridisation showed that the PmAG mRNA was highly-expressed in the sepals, carpels and stamens, and a weak signal was detected in the seeds and nutlets. No expressions were detected in the leaves or petals, but no significant differential was expressed between perfect and imperfect flowers [3]. Meanwhile, comparative proteomic analyses were performed on perfect and imperfect flowers, and several differently-expressed proteins were identified [13]. However, the type of molecular mechanism involved in pistil abortion remains unknown in Japanese apricot.

              Small RNAs (sRNAs) are low molecular weight RNAs with regulatory functions. Based on differences in biogenesis and action, sRNAs are grouped into two categories: short interfering RNAs (siRNAs) and microRNAs (miRNAs) [14, 15]. MicroRNAs are non-coding RNAs, 21–24 nucleotides (nt) long, which regulate gene expression at the post-transcriptional level [1618]. In plants, miRNAs are processed from the stem-loop regions of long primary transcripts by a Dicer-like enzyme and are loaded into silencing complexes, where they generally direct the cleavage of complementary mRNAs [17]. Identified in plants less than 10 years ago [19, 20], miRNAs are already known to play numerous crucial roles at each major stage of development, typically at the cores of gene regulatory networks, targeting genes that are themselves regulators, such as those that encode transcription factors, suggesting that plant miRNAs are master regulators [18, 21]. Among non-transcription factor targets, many miRNAs encode F-box proteins or ubiquitin-conjugating enzymes implicated in targeting selected proteins for proteasomal degradation, indicating miRNAs play a role in regulating protein stability and plant development [22, 23]. miR156, miR163, miR169, miR172, miR398 and miR399 play important roles in flowering-time regulation and belong to ambient temperature-responsive miRNAs in plants [9, 24]. miR172 has also acquired specialised species-specific functions in other aspects of plant development, such as cleistogamy and tuberisation [6].

              The fact that a large number of the known miRNAs in the plant kingdom, from mosses and ferns to higher flowering plants, are evolutionarily conserved has been used as a practical indicator for the identification or prediction of miRNAs using homology searches in other species [25, 26]. Recently developed, next-generation, high-throughput sequencing technologies provide a powerful tool for identifying, as well as quantifying, miRNAs. These technologies open up the possibility of exploring sRNA populations in economically important species such as Arabidopsis thaliana[27, 28], Oryza sativa[29, 30], Populus trichocarpa[31, 32], Vitis vinifera[33], Arachis hypogaea[34], Citrus sinensis[35], Citrus trifoliate[36], Medicago truncatula[37, 38], Glycine max[39], Carthamus tinctorius Cucumis sativus[40], Rehmannia glutinosa[41] and others. By means of high-throughput sequencing, miR164 and miR169 were shown to be drought-responsive miRNAs in Medicago truncatula[37]. miR167, miR1857 and miR172a are involved in the mutant trait formation of lycopene accumulation in sweet orange [35].

              Although miRNAs have been extensively studied in the past, there has be no systematic examination of miRNAs performed on the Japanese apricot. To investigate the role of miRNAs on the pistil development of Japanese apricot, high-throughput sequencing technology (Solexa) was employed to survey sRNA populations from perfect and imperfect flower buds.

              Results

              High-throughput sequencing of small RNAs from Japanese apricot flower bud tissue

              To identify miRNAs involved in the development of Japanese apricot flowers, Solexa sequencing was used on libraries of small RNAs from perfect and imperfect flower buds. A total of 22,561,972 and 24,952,690 reads were obtained from perfect and imperfect flower bud libraries, respectively, after filtering out those reads without small RNA sequences, ranging from 18 to 30 nt in length (Figure 1), of which the majority were 19–25 nt long. The most abundant small RNAs in the perfect and imperfect libraries were 21 nt and 24 nt long, respectively. The distribution of 21 nt small RNAs was approximately 28.35% and 32.31% in perfect and imperfect libraries, respectively, while the distribution of 24 nt small RNAs was approximately 40.08% and 31.17% in the perfect and imperfect libraries, respectively. After removal of the adaptor, insert, poly(A) and short RNAs of <18 nt, 21,985,053 and 24,239,332 redundant clean reads were obtained from the perfect and imperfect flower buds, respectively, including rRNA, tRNA, snRNA, snoRNA, miRNA and several other unannotated reads (Tables 1 and 2). Of these clean reads, 11.76% (unique, 43.32%) were perfect-specific, 10.88% (unique, 40.35%) were imperfect-specific, and 77.36% (unique, 16.33%) were present in both (Figure 2). The average number of common sequence frequency was 20.67, while that of library-specific reads was not more than 1.2 (Table 3). Among the sRNAs sequenced, unannotated redundant reads accounted for 77.83% and 74.25% for perfect and imperfect flower buds, respectively.
              http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-13-371/MediaObjects/12864_2011_4175_Fig1_HTML.jpg
              Figure 1

              Length distribution of the small RNA library in Japanese apricot perfect and imperfect libraries.

              Table 1

              Summary of data cleaning produced by small RNA sequencing (perfect and imperfect flower buds)

              Type

              Perfect

              Imperfect

              Count

              Percent (%)

              Count

              Percent (%)

              Total reads

              22,561,972

               

              24,952,690

               

              High quality

              22,135,703

              100%

              24,466,679

              100%

              3′ adapter null

              53,592

              0.24%

              49,464

              0.20%

              Insert null

              6,598

              0.03%

              8,281

              0.03%

              5′ adapter contaminants

              36,203

              0.16%

              58,925

              0.24%

              Smaller than 18nt

              48,147

              0.22%

              107,094

              0.44%

              Poly(A)

              6,110

              0.03%

              3,583

              0.01%

              Table 2

              Distribution of small RNAs among different categories (perfect and imperfect flower buds)

              Category

              Perfec0074

              Imperfect

              Unique reads

              Redundant reads

              Unique reads

              Redundant reads

              Total

              6,317,546 (100%)

              21,985,053 (100%)

              6,002,602 (100%)

              24,239,332 (100%)

              rRNA

              55,021 (0.87%)

              1,990,779 (9.06%)

              63,243 (1.05%)

              2,844,574 (11.74%)

              snRNA

              4,443 (0.07%)

              31,490 (0.14%)

              5,145 (0.09%)

              40,170 (0.17%)

              snoRNA

              1,376 (0.02%)

              6,672 (0.03%)

              1,445 (0.02%)

              7,517 (0.03%)

              tRNA

              10,502 (0.17%)

              364,461 (1.66%)

              11,885 (0.20%)

              698,413 (2.88%)

              miRNA

              26,734 (0.42%)

              2,479,659 (11.28%)

              30,931 (0.52%)

              2,649,934 (10.93%)

              Unannotated

              6,219,470 (98.45%)

              17,111,992 (77.83%)

              5,889,953 (98.12%)

              17,998,724 (74.25%)

              http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-13-371/MediaObjects/12864_2011_4175_Fig2_HTML.jpg
              Figure 2

              Summary of common and specific sequences between perfect and imperfect libraries. (A)Total sRNAs and (B)Unique sRNAs.

              Table 3

              Small RNA sequences and mean frequencies in both perfect and imperfect libraries

              Class

              Unique sRNAs

              Total sRNAs

              Mean frequency

              Total sRNAs

              10590449

              46224385

              4.36

              Perfect and imperfect common

              1729699

              35758031

              20.67

              Perfect specific

              4587847

              5437697

              1.19

              Imperfect specific

              4272903

              5028657

              1.18

              Identification of known miRNAs and evolutionary conservation

              To identify the known miRNAs, the sRNA library was BLASTN searched for known mature plant miRNAs in miRBase 17.0 (April 2011). Following the BLASTN searches and further sequence analysis, 61 unique sequences, belonging to 24 families, in the perfect and imperfect libraries were found to be orthologues of known miRNAs from other plant species, which had previously been deposited in the miRBase database (Table 4).
              Table 4

              Known miRNAs in perfect and imperfect libraries

              Family

              miRNA name

              Perfect

              Imperfect

              Counts

              Normalised

              Counts

              Normalised

              MIR156

              miR156a

              45352

              2062.86

              61361

              2531.46

               

              miR156b

              26572

              1208.64

              29886

              1232.95

               

              miR156c

              145205

              6604.71

              210543

              8686.01

               

              miR156f

              118

              5.37

              188

              7.76

               

              miR156h

              0

              0.01

              4

              0.17

               

              miR156k

              25

              1.14

              46

              1.90

               

              miR157a

              735314

              33446.09

              658343

              27160.11

               

              miR157d

              8866

              403.27

              8738

              360.49

              MIR159

              miR159a

              18682

              849.76

              38726

              1597.65

               

              miR319

              21

              0.96

              171

              7.05

               

              miR319a

              121

              5.50

              1172

              48.35

               

              miR319c

              6

              0.27

              7

              0.29

               

              miR319e

              1

              0.05

              40

              1.65

               

              miR319g

              0

              0.01

              5

              0.21

              MIR160

              miR160a

              110

              5.00

              808

              33.33

              MIR162

              miR162

              1

              0.05

              4

              0.17

               

              miR162a

              718

              32.66

              617

              25.45

              MIR164

              miR164a

              6256

              284.56

              4134

              170.55

               

              miR164f

              63

              2.87

              52

              2.15

              MIR166

              miR166

              60

              2.73

              85

              3.51

               

              miR166a

              222689

              10129.11

              281639

              11619.09

               

              miR166h

              1369

              62.27

              2013

              83.05

              MIR167

              miR167-3p

              810

              36.84

              691

              28.51

               

              miR167a

              151440

              6888.32

              127360

              5254.27

               

              miR167d

              52161

              2372.57

              45113

              1861.15

               

              miR167f

              61643

              2803.86

              44482

              1835.12

              MIR168

              miR168a

              64099

              2915.57

              82261

              3393.70

              MIR169

              miR169b

              510

              23.20

              538

              22.20

               

              miR169e

              10

              0.45

              6

              0.25

               

              miR169g

              11

              0.50

              1

              0.04

               

              miR169h

              18

              0.82

              10

              0.41

              MIR171

              miR171

              483

              21.97

              630

              25.99

               

              miR171b

              1578

              71.78

              1994

              82.26

               

              miR171d

              1

              0.05

              0

              0.01

               

              miR171f

              13

              0.59

              15

              0.62

               

              miR171b-3p

              2195

              99.84

              2831

              116.79

               

              miR171l

              4

              0.18

              9

              0.37

              MIR172

              miR172a

              13173

              599.18

              10393

              428.77

               

              miR172b

              5

              0.23

              0

              0.01

               

              miR172e

              181

              8.23

              181

              7.47

               

              miR172g

              123

              5.59

              102

              4.21

              MIR2111

              miR2111a

              0

              0.01

              5

              0.21

              MIR390

              miR390a

              18872

              858.40

              32445

              1338.53

               

              miR390a-3p

              602

              27.38

              1207

              49.80

              MIR393

              miR393

              221

              10.05

              603

              24.88

               

              miR393a

              2

              0.09

              77

              3.18

               

              miR393b

              4

              0.18

              3

              0.12

              MIR394

              miR394a

              24

              1.09

              301

              12.42

              MIR395

              miR395a

              14

              0.64

              94

              3.88

               

              miR395b

              1

              0.05

              2

              0.08

              MIR396

              miR396a

              2046

              93.06

              3149

              129.91

               

              miR396b

              869

              39.53

              1194

              49.26

              MIR398

              miR398

              0

              0.01

              1

              0.04

               

              miR398a

              13

              0.59

              16

              0.66

               

              miR398b

              7

              0.32

              12

              0.50

              MIR399

              miR399a

              0

              0.01

              7

              0.29

               

              miR399f

              29

              1.32

              45

              1.86

              MIR403

              miR403

              325

              14.78

              510

              21.04

              MIR408

              miR408

              19

              0.86

              14

              0.58

              MIR535

              miR535a

              9743

              443.16

              12158

              501.58

              MIR827

              miR827a

              22512

              1023.97

              21786

              898.79

              MIR828

              miR828a

              48

              2.18

              48

              1.98

              The number of members in differently-conserved miRNA families was analysed (Figure 3). A majority of the 24 miRNA families contained several members, and three families (miR156, miR159 and miR171) possessed multiple members, with 8, 6 and 5 members, respectively. Nine miRNA families, namely miR160, miR168, miR394, miR403, miR408, miR535, miR827, miR828 and mir2111, had only one member.
              http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-13-371/MediaObjects/12864_2011_4175_Fig3_HTML.jpg
              Figure 3

              Member numbers of identified miRNAs in each conserved miRNA family in Japanese apricot.

              The counts of reads for known miRNA families were also analysed, and it was found they indicated large divergences in expression frequency among these miRNAs. The number of reads for conserved miRNAs sequenced from the same, or different, miRNA families also varied drastically, with miR156, miR166 and miR167 represented most frequently in the two libraries. Of these, miR156 was represented the most frequently, with 961,452 and 969,109 copies in the perfect and imperfect libraries, respectively. miR156, miR169, miR827 and miR828 were moderately abundant in the two libraries, while miR2111 was absent from the perfect library. It appeared, therefore, that the miRNA population present in the perfect library differed from that present in the imperfect library to some extent (Figure 4).
              http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-13-371/MediaObjects/12864_2011_4175_Fig4_HTML.jpg
              Figure 4

              Counts of identified miRNAs in each conserved miRNA family in Japanese apricot.

              To investigate the evolutionary roles of these known miRNAs, extensive comparisons were performed against known miRNAs in other plant species, including Physcomitrella, Selaginella, Picea, Pinus, Arabidopsis, Brassica, Ricinus, Glycine, Medicago, Gossypium, Solanum, Aquilegia, Citrus, Populus, Vitis, Oryza, Sorghum and Zea (Figure 5). Among the miRNA sequences obtained from Japanese apricot, members in five of families (miR403, miR535, miR827, miR828 and miR2111) showed a lack of conservation of sequence identity compared to orthologues from 18 other plant species. Generally, Japanese apricot miRNAs had corresponding homologues in at least two plant species. Japanese apricot, Arabidopsis and Vitis vinifera shared 23 conserved miRNA families. Twelve (miR156, miR159, miR160, miR166, miR167, miR171, miR390, miR395, miR396, miR398, miR408 and miR535) out of 24 families had orthologues in Coniferophyta and Embryophyta, indicating that these 12 Japanese apricot miRNA families are ancient. Twelve (miR162, miR164, miR168, miR169, miR172, miR393, miR394, miR399, miR403, miR827, miR828 and miR2111) out of 24 families only had homologues in angiosperm, indicating that these 12 Japanese apricot miRNA families are recent. In addition, miR403, miR828 and miR2111 only had homologues in eudicotyledons, suggesting that these miRNAs are probably involved in the regulation of specific development, such as the development of embryos and cotyledons.
              http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-13-371/MediaObjects/12864_2011_4175_Fig5_HTML.jpg
              Figure 5

              Known miRNAs from Japanese apricot, designated as pmu on the first column, and their homologs in other plant species.

              Identification of potentially novel miRNAs/new members of known miRNA families and nucleotide bias

              The Mireap prediction software developed by the Beijing Genomics Institute (Shenzhen, China) was used to identify potentially novel miRNAs and new members of known miRNA families by exploring the secondary structure based upon a trans-species alignment of apricot small RNA data against the peach (Prunus persica) genome. After removal of the conserved miRNAs, sequences were aligned with the peach genome sequence. A total of 405 and 423 miRNA candidates were obtained from the perfect and imperfect flower bud libraries, respectively. The prediction of potentially novel miRNA/new members of known miRNA families candidates was summarised, including the base bias on the first position among small RNA candidates of certain lengths. Based on this summary, prediction accuracy could be assessed according to the base bias of known miRNAs. The majority of these novel miRNA candidates had lengths of 21 and 22 nt, and started with a 5′ U (Figure 6A and B).
              http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-13-371/MediaObjects/12864_2011_4175_Fig6_HTML.jpg
              Figure 6

              Novel miRNA candidates first nucleotide bias in Japanese apricot. (A) Perfect library and (B) Imperfect library.

              Among the miRNA candidates, 61 were identified with complementary miRNA*s (fold-back structures in Additional files 1 and 2), indicating that these candidate miRNAs were most likely new in Japanese apricot, and several potentially novel ones may be unique to Japanese apricot or Prunus plants. The counts of several miRNA*s of these potentially novel miRNAs were low (Table 5). Nevertheless, no requirement for counts of miRNA*s was given in the most recent criteria for the annotation of plant miRNAs [42]. Therefore, these miRNAs were still considered to be potentially new. Candidate miRNAs with only one miRNA* have been identified as new miRNAs in rice and leguminous plants. The minimum free energy (MFE) for the hairpin structures of miRNA precursors was lower than −18 kcal/mol, and the length of new miRNA precursors ranged from 74 nt to 377 nt (Table 5).
              Table 5

              Novel miRNAs/new members of known miRNA families in perfect and imperfect libraries

              miRNA

              Length of mature(nt)

              Sequence(5′–3′)

              Counts of miRNAs/miRNA*s

              Location

              Length of precursors(nt)

              Arm

              MFE (kcal/mol)

              miR6257

              21

              TCTTAACTGTTGGATTAGGCT

              22/1

              scaffold_10:708566:708677:−

              112

              5′

              −26.7

              miR6258

              21

              TTCCAGCTGTAAAGATCAAGA

              5/5

              scaffold_1:230373:230544:+

              172

              5′

              −88.7

              miR6259

              21

              TAGAAAAATACGGGCGATAAA

              6/1

              scaffold_1:37406755:37406880:+

              126

              3′

              −53.6

              miR6260

              21

              TGGAGTGAGAGAATGGGAGGT

              14/2

              scaffold_1:40569695:40569796:+

              102

              3′

              −50.4

              miR6261

              22

              AAGTGATTATATGGAGAAGCAC

              13/1

              scaffold_1:46392103:46392176:+

              74

              3′

              −26.5

              miR6262

              21

              TCTTTAGAAAGTTAGAATTGT

              5/1

              scaffold_1:23904565:23904750:−

              186

              5′

              −67

              miR6263

              21

              AAGTGGACAAAAGGGGAGTGG

              16/2

              scaffold_2:16774627:16774733:+

              107

              3′

              −24.9

              miR6264

              21

              ATGCCTATGGACACGTGTCAA

              6/1

              scaffold_2:10473541:10473644:−

              104

              3′

              −56.02

              miR6265

              23

              TTGAACTTTGACCCGATTCGCAT

              15/1

              scaffold_3:13798983:13799084:+

              102

              5′

              −36.77

              miR6266a

              21

              TAAATGCAGGGGCAAAATGAT

              149/4

              scaffold_4:6953607:6953883:+

              277

              5′

              −69.81

              miR6266b

              21

              TAAATGCAGGGGCAAAATGAT

              109/2

              scaffold_4:8221370:8221603:+

              234

              5′

              −60.63

              miR6266c

              21

              TAAATGCAGGGGCAAAATGAT

              106/1

              scaffold_7:12665062:12665327:−

              266

              5′

              −59.43

              miR6267a

              21

              TAGAGAGGTGGTACAATTGTG

              45/1

              scaffold_4:9720663:9720766:+

              104

              3′

              −69.6

              miR6267b

              21

              ATTAGAGAGGCGGTAAACAAT

              5/1

              scaffold_4:13686619:13686731:−

              113

              3′

              −35.9

              miR6268

              21

              TGAGGAGATGGAGAGTAGATA

              244/3

              scaffold_4:16645739:16645874:+

              136

              5′

              −77.7

              miR6269

              21

              TGTGAATAGTGATTGCCATGG

              18/5

              scaffold_4:20136895:20136989:+

              95

              5′

              −36.7

              miR6270

              21

              TTCTGGTATTGGAATTTCATT

              259/26

              scaffold_4:30105651:30106027:+

              377

              3′

              −117.7

              miR6271

              21

              TCAAGATTGAGAGATATAATG

              24/3

              scaffold_4:8916468:8916590:−

              123

              3′

              −34.3

              miR6272

              21

              TAGCTGTAAATGAGTGTTTTT

              5/1

              scaffold_4:19289821:19289925:−

              105

              5′

              −25.8

              miR6273

              21

              AATGCAGCATGATTTTTTTTT

              81/63

              scaffold_5:3421010:3421132:+

              123

              3′

              −42.2

              miR6274

              23

              TATTTTGCTATCTTCGGGCAATA

              15/2

              scaffold_5:3414706:3414834:−

              129

              5′

              −35.8

              miR6275

              22

              AGTGGAAGTAGCAAGGGGAAGC

              14/1

              scaffold_5:10005396:10005502:−

              107

              3′

              −67.6

              miR6276

              21

              AAAGGCTCATACAAATATTCC

              14/3

              scaffold_6:8093383:8093491:−

              109

              5′

              −21.7

              miR6277

              21

              TGTGTGTGGAAAGAGCGAGAC

              1661/5

              scaffold_6:28212589:28212684:−

              96

              3′

              −47.16

              miR6278

              22

              TGAACCTTGTGTACAAATTGGC

              16/3

              scaffold_7:7789275:7789372:+

              98

              3′

              −41.9

              miR6279

              21

              TAGACAAGAATTCCAGAGACC

              9/1

              scaffold_7:16179849:16180001:+

              153

              3′

              −31.4

              miR6280

              21

              TTGGCAGTAAGATTTTTGGTG

              15/2

              scaffold_7:8897336:8897500:−

              165

              5′

              −42.1

              miR6281

              21

              GTTAGAGATAGAGAGAGTGAG

              60/21

              scaffold_8:277682:277841:+

              160

              5′

              −86

              miR6282

              23

              GTTGATCGATGTGGGATGTTACA

              8/1

              scaffold_8:11190431:11190772:+

              342

              5′

              −93.3

              miR6283

              21

              CAAAAGGGGAGTGGGAAAATC

              33/2

              scaffold_8:19627180:19627307:+

              128

              3′

              −64.9

              miR6284

              21

              TTTGGACCATGGATGAAGATT

              5128/2

              scaffold_8:20948100:20948196:+

              97

              3′

              −31.9

              miR6285

              22

              TAGTGAAGTTTGAATTAGGGCT

              2195/3

              scaffold_8:16684630:16684710:−

              81

              5′

              −38

              miR6286

              23

              TTTGAACCATTGGATCGTAGTTA

              8/1

              scaffold_14:309411:309508:−

              98

              5′

              −21.8

              miR6287

              21

              CAAGAAGTGGAAGTTTTGGGC

              5/1

              scaffold_1:17236128:17236204:−

              77

              5′

              −31.3

              miR6288

              21

              GAAAATGACAAGTGGCTAGTT

              27/13

              scaffold_2:18743450:18743549:+

              100

              3′

              −51.3

              miR6289

              21

              TCCTTTGAATGGTTAGGCTCA

              7/1

              scaffold_3:4077260:4077364:−

              105

              3′

              −51.2

              miR6290

              23

              TGAATGAGTTCAGAGATCGTGTA

              17/12

              scaffold_4:28016862:28016957:+

              96

              3′

              −18.7

              miR6291a

              21

              CTTACCACATTTTTATACCAT

              67/1

              scaffold_4:8758152:8758281:−

              130

              5′

              −66.31

              miR6291b

              21

              CTTACCACATTTTTATACCAT

              67/4

              scaffold_7:5853383:5853533:+

              151

              5′

              −41.6

              miR6292

              21

              TATCTTTTAATCGTTAGATCA

              18/1

              scaffold_4:11582347:11582421:−

              75

              5′

              −29.99

              miR6293

              21

              TAAGAGGCTGATGACTAAAAC

              355/9

              scaffold_5:2922263:2922370:+

              107

              5′

              −59.8

              miR6294

              21

              TGGTGTAGGCTAATCACAATC

              7/1

              scaffold_5:18324006:18324209:+

              204

              3′

              −89.9

              miR6295

              21

              GAGGACAGAAGATGATTCAGC

              42/10

              scaffold_6:25684504:25684833:+

              330

              3′

              −155.3

              miR6296

              21

              TAAGGCCCTTAGATGAGACCC

              10/1

              scaffold_6:28262446:28262576:+

              131

              3′

              −56

              miR6297a

              23

              AATAATTTTTCGTCGCGCAAAAT

              10/1

              scaffold_8:6395625:6395769:+

              145

              3′

              −63.2

              miR6297b

              23

              GATGTATTGTCGTCGCGCAAAGT

              11/11

              scaffold_8:2802801:2802903:−

              103

              3′

              −54.6

              miR171a

              21

              TGATTGAGCCGTGCCAATATC

              1651/29

              scaffold_3:16557250:16557364:+

              115

              3′

              −58.4

              miR171c

              21

              TGATTGAGCCGTGCCAATATC

              1586/1

              scaffold_3:21505898:21505996:−

              99

              3′

              −46.3

              miR171e

              21

              TTATTGAACCGGACCAATATC

              10/1

              scaffold_3:16557258:16557354:−

              97

              3′

              −39.8

              miR171g

              21

              TGATTGAGCCGTGCCAATATC

              3634/3

              scaffold_5:13607844:13607938:−

              95

              3′

              −46.5

              miR171h

              21

              TTGAGCCGCGTCAATATCTCC

              1141/43

              scaffold_3:16525596:16525722:+

              127

              3′

              −44.32

              miR319b

              22

              TAGCTGCCGAGTCATTCATCCA

              71/30

              scaffold_5:11602974:11603095:−

              122

              5′

              −49.26

              miR394

              21

              AAGCGTTTCTTACAGAGTTTA

              130/4

              scaffold_1:32136105:32136248:−

              144

              5′

              −65

              miR477a

              21

              GTTGGGGGCTCTTTTGGGACG

              161/28

              scaffold_3:9747726:9747847:−

              122

              3′

              −58.5

              miR477b

              21

              GTTGGGGGCTCTTTTGGGACG

              161/28

              scaffold_3:9752784:9752905:−

              122

              3′

              −62.1

              miR482a

              22

              TTTCCGAAACCTCCCATTCCAA

              1293/75

              scaffold_1:29646062:29646181:+

              120

              3′

              −47.2

              miR482b

              22

              CTTCCCAAACCTCCCATTCCTA

              4677/518

              scaffold_1:29648520:29648655:+

              136

              3′

              −55.5

              miR482c

              20

              GGAATGGGCTGTTTGGGATG

              30342/30319

              scaffold_3:10579287:10579407:+

              121

              5′

              −63.6

              miR482d

              22

              CCTCCCATGCCACGCATTTCTA

              20734/3022

              scaffold_8:10608388:10608531:−

              144

              3′

              −59.3

              miR482e

              22

              TTGCCTATTCCTCCCATGCCAA

              210/2

              scaffold_1:29646743:29646870:+

              128

              3′

              −55

              miR828

              21

              TCATTTCAGCAAGCAGCGTTA

              1491/1

              scaffold_2:25971195:25971319:−

              125

              3′

              −55.9

              Differentially expressed miRNAs between perfect and imperfect flower bud libraries

              Small RNAs in the perfect and imperfect libraries were enriched for lengths of 21–24 nt (Figure 1), a typical range for plant miRNAs. For small RNAs shorter than 23 nt, the imperfect flower buds had higher expression levels than the perfect flower buds, while for small RNAs longer than 23 nt, the opposite was the case. In addition to the different length distributions of small RNAs, the proportions of each type of small RNA in the two libraries were also different (Table 2). The proportion of miRNAs in perfect flower buds was higher than that in imperfect flower buds. However, rRNAs, snRNAs and tRNAs in imperfect flower buds were higher than in perfect flower buds. In summary, the small RNA transcriptomes of the two libraries exhibited certain differences with respect to length distribution and composition.

              In order to identify miRNAs related to pistil development, the normalised expressions of miRNAs in the perfect and imperfect small RNA libraries were compared. The miRNAs with changes in expression levels greater than 1.5-fold and p-values less than 0.05 are presented in Table 6. The results from high-throughput sequencing showed that seven known miRNAs and six potentially novel miRNAs/new members of known miRNA families were relevant to pistil development (Table 6). Of these 13 sequences, nine demonstrated a greater than three-fold change in expression levels between the perfect and imperfect libraries. Among the six differentially expressed potentially novel miRNAs/new members of known miRNA families, miR6274 and miR482c were perfect specific, while miR6295, mi171d and miR319b were imperfect specific. Three miRNAs were down-regulated, and ten miRNAs were up-regulated in pistil abortion (Table 6).
              Table 6

              miRNAs expressed differentially in perfect and imperfect libraries

              Family

              miRNA name

              Perfect

              Imperfect

              Fold-change log2(s2/s1)

              P-value

              Mode

              Sig-lable

              Counts

              Normalised

              Counts

              Normalised

              MIR159

              miR319

              21

              0.96

              171

              7.05

              2.88

              1.45e − 06

              Up

              **

               

              miR319a

              121

              5.50

              1172

              48.35

              3.14

              0

              Up

              **

               

              miR319e

              1

              0.05

              40

              1.65

              5.18

              0

              Up

              **

              MIR160

              miR160a

              110

              5.00

              808

              33.33

              2.74

              0

              Up

              **

              MIR393

              miR393a

              2

              0.09

              77

              3.18

              5.13

              6.41e − 12

              Up

              **

              MIR394

              miR394a

              24

              1.09

              301

              12.42

              3.51

              9.05e − 51

              Up

              **

              MIR395

              miR395a

              14

              0.64

              94

              3.88

              2.61

              6.82e − 25

              Up

              **

              unknown

              miR6274

              60

              2.73

              0

              0.01

              −8.09

              0

              Down

              **

              unknown

              miR6268

              178

              8.10

              66

              2.72

              −1.57

              0

              Down

              **

              unknown

              miR6295

              0

              0.01

              42

              1.73

              7.44

              1.97e − 37

              Up

              **

              MIR159

              miR319b

              0

              0.01

              71

              2.93

              8.19

              4.14e − 99

              Up

              **

              MIR171

              miR171d

              0

              0.01

              2097

              86.51

              13.08

              0

              Up

              **

              MIR482

              miR482c

              30342

              1380.12

              0

              0.01

              −17.07

              0

              Down

              **

              To confirm the differential expression of the miRNAs, the expressions of four of the seven known miRNA genes and five of the six novel miRNA genes were analysed using poly(A) qRT-PCR. The expression level of each gene in the perfect and imperfect flower buds was compared with its abundance in the sequencing data of the sRNA library. The results indicated that nine miRNAs had the same expression patterns in the perfect and imperfect flower buds as those in the sequencing data (Figure 7).
              http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-13-371/MediaObjects/12864_2011_4175_Fig7_HTML.jpg
              Figure 7

              Expression confirmation of miRNAs in Japanese apricot derived from high throughput sequencing. Differentially expressed miRNAs expression detected by poly(A) qRT-PCR.

              Prediction of potential targets of differentially expressed miRNAs

              An indication of the genes responsible for pistil abortion was sought by the inspection of 212 potential targets of the 13 differentially expressed miRNAs (Additional file 3). There are three ontologies in Gene Ontology (GO): molecular functions, cellular components and biological processes. GO categories were assigned to all 212 putative targets, according to their cellular components, molecular functions and biological processes (Figure 8). On the basis of molecular function, the genes were finally classified into 10 categories, as shown in Figure 8B. The top three over-represented GO terms are enzyme activity, nucleic acid binding and other binding. Thirteen biological processes were identified, with the three most frequent being developmental process, regulation of transcription and response to stress (Figure 8C).
              http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-13-371/MediaObjects/12864_2011_4175_Fig8_HTML.jpg
              Figure 8

              Gene ontology of the predicted targets for 13 differentially expressed miRNAs. Categorization of miRNA-target genes was performed according to the cellular component (A), molecular function (B) and biological process (C).

              The high frequency of ‘regulation of transcription’ and ‘response to stress’ terms are easily explainable, since miRNAs are involved in diverse regulatory events [43]. Moreover, many flower developmental genes were also predicted targets of miRNAs. One gene involved in ovule development was further analysed (miR319, miR319a and miR319e and putative target auxin response factor 2 (ARF2) [Ppa022314m]). The results implied the possible roles of miRNAs in the regulation of biological processes involved in pistil abortion.

              Discussion

              High-throughput sequencing of Japanese apricot small RNAs

              Most conserved miRNAs in plants have been identified by traditional Sanger sequencing or computational approaches [4347]. However, a large number of non-conserved or species-specific miRNAs in plants usually accumulate at a lower level than conserved miRNAs, and are typically not easily revealed using traditional sequencing methods [48]. Therefore, the construction and high-throughput sequencing of small RNA libraries seems to be the most efficient method for miRNA identification [36, 49]. The aim of this work was to identify the evolutionary known and potentially novel Japanese apricot-specific miRNAs recovered from perfect and imperfect flower bud libraries, and to analyse the differentially expressed miRNAs associated with pistil development. In our study, small RNA libraries of Japanese apricot from the Solexa platform, one of the newly-developed high-throughput sequencing technologies, generated shorter reads (up to 35 bp) but yielded 1–3 million reads per sample. This method has been most popularly employed to discover miRNAs in various organisms. As expected, a large number of reads were generated by our small RNA libraries, of which 61 are known to belong to 24 families. In addition, 61 potentially novel miRNAs/new members of known miRNA families were identified in Japanese apricot.

              Taking a broader view of the high-throughput sequencing of small RNAs in Japanese apricot, it was observed that small RNAs of 24 nt dominated the library of unique species, as has been reported for many other plant species, such as Arabidopsis thaliana[28], Citrus trifoliata[36], Medicago truncatula[37, 38], Citrus sativus[50] and Citrus Sinensis[51]. However, the most abundant small RNAs in the imperfect library were 21 nt long. Normally, the length of small RNAs is between 18 nt and 30 nt. Length distribution analysis is a helpful way to assess the composition of small RNA samples. For example, miRNA is normally 21 nt or 22 nt long, whereas siRNA is 24 nt long [52]. The data obtained here imply that the most abundant small RNAs are miRNAs and siRNAs in perfect and imperfect flower buds, respectively.

              The overall distribution pattern of small RNAs (21 nt sRNAs = 30.33%, and 24 nt sRNAs = 35.63%) in Japanese apricot is significantly different from that in Pinus contorta, a conifer species in which 21 nt RNAs are more abundant (>50%) and 24 nt RNAs are less frequent (2.5%). A striking difference also exists when comparing Japanese apricot small RNAs with monocot species of rice. When compared with eudicotyledon species of sweet orange, the difference is not as noticeable, but still exists, such that 24 nt sRNAs are most frequent (>50%) while 21 nt sRNAs are less common (<20%). These analyses indicate that the small RNA transcriptome is complicated across plant species and can be significantly different between phylogenetically distant plant families.

              miRNAs identified in plant flowers

              Arabidopsis miRNAs [27] regulate multiple developmental events. In the past, miRNA identification in flowers using sequencing approaches has been common, and has been applied in the study of Arabidopsis[53], tomato [54], orchid [24], Boechera[12], maize [55], cotton [49], safflower and grape [56, 57]. In this study, high-throughput sequencing of extracts from Japanese apricot flower buds led to the identification of 61 known miRNAs, belonging to 24 families, and 61 potentially novel miRNAs/new members of known miRNA families. Analysis of these revealed that some miRNA families are expressed in the flowers of other plant species, but they are not flower-specific. miR156/miR157, miR166 and miR167 were represented most frequently in the libraries in this study. The involvement of three miRNA families (miR172, miR159/miR319 and miR156) in flowering-time regulation has been recently demonstrated in other investigations [22]. miR164, miR319, miR159 and miR167 specify particular cell types during the later stages of flower development [7]. Furthermore, the comparison of these species’ miRNAs showed that miR156/miR157 and miR172 may be components of a regulatory pathway mediating the transition between the vegetative and reproductive phases in plants. In addition, miR172 regulates stem cell fate and defines the inner boundary of APETALA3 and pistillata expression domains in Arabidopsis floral meristems [58]. By targeting APETALA2 and type III homeodomain-leucine zipper (HD-Zip) genes, miR166 regulates the temporal program of floral stem cells [59]. It is believed that miR167, like miR160, targets mRNAs coding for ARF, which are DNA-binding proteins that are thought to control transcription in response to the phytohormone auxin [27, 60]. Transcriptional regulation is important for many of the diverse developmental responses to auxin signals, which include cell elongation, division and differentiation in both roots and shoots [61].

              miRNAs possibly involved in the regulation of pistil abortion in imperfect Japanese apricot flower buds

              The characterisation and comparative profiling of entire sets of small RNAs (small RNA transcriptome), especially miRNAs, provides the foundation for unraveling the complex miRNA-mediated regulatory networks controlling pistil abortion in imperfect Japanese apricot flower buds. In this study, a number of miRNAs were shown to be differentially expressed between perfect and imperfect flower buds. Compared with the perfect library, four known miRNA genes and three potentially novel miRNA/new members of known miRNA families genes were expressed exclusively in imperfect flower buds. On the other hand, it was found that two potentially novel miRNAs/new members of known miRNA families were perfect-specific. Moreover, a total of seven known miRNAs and six potentially novel miRNAs exhibited significant expression changes between the perfect and imperfect libraries.

              The relationship between the sRNA genes and the miRNA target genes is one of the hot spots in the phenomenon of ‘miRNA-associated transitivity’. Target prediction of these differential miRNAs could provide information on the biological processes regulated by miRNA. The annotations of these potential miRNA target genes provided an alternate view of gene regulation of the pistil abortion trait formation in imperfect flower buds. It was discovered that these groups of predicted miRNA-target genes are possibly involved in the pistil abortion trait formation.

              The majority of genes encoding transcription factors or F-box proteins have a significant role in the plant development [44, 62]. In the present study, it was found that the predicted targets of miR319, miR319a, miR319e, miR160, miR393, miR394, miR6274, miR6295 and miR171d were either transcription factors or F-box proteins. In addition, it is predicted that miR319/miR319a/miR319e target ARF2 genes and that miR160a targets ARF16/17. Auxin regulates a variety of physiological and developmental processes in plants. ARF has been reported to regulate flower and leaf development [8, 63, 64]. ARF2 is a transcriptional suppressor that has been found to be involved in ethylene, auxin, ABA and brassinosteroid pathways, in order to control the onset of leaf senescence, floral organ abscission and ovule development [64]. ARF2 promotes transitions between multiple stages of Arabidopsis development and positively regulates flower development [65]. In this study, the expression of miR319/miR319a/miR319e was shown to be higher in imperfect than in perfect flower buds. Consequently, the expression of ARF2 was repressed by these miRNAs and thus regulated pistil development. Moreover, TCP2 (TEOSINTE BRANCHED/CYCLOIDEA/PCF) transcription factor genes and MYB33, which belong to a GAMYB-like family of transcription factors, are also targets of miR319/miR319a/miR319e in our prediction, which agrees with previous reports [10, 66]. Therefore, it is conceivable that the over-expression of miR319/miR319a/miR319e may contribute to an increase in imperfect flower ratios in pistil development.

              Conclusions

              The present study first comparatively constructed the miRNAomes between perfect and imperfect Japanese apricot flowers and identified 61 known miRNAs belonging to 24 families. Comparative profiling revealed that seven known miRNAs exhibited significant expression differences between perfect and imperfect flower buds. In addition, 61 potentially novel miRNAs/new members of known miRNA families were also identified, by the presence of mature miRNAs and corresponding miRNA*s in the sRNA libraries. Comparative analysis showed that six potentially novel miRNAs were differentially expressed between perfect and imperfect flower buds. Target predictions of the 13 differential miRNAs resulted in 212 target genes. GO annotation revealed that highly-ranked miRNA target genes were those implicated in the developmental process, regulation of transcription and response to stress. These findings, both computational and experimental, provide valuable information for further functional characterisation of miRNAs associated with pistil development in plants.

              Methods

              Plant materials

              The frequency of imperfect flowers in Japanese apricot cultivar ‘Daqiandi’ is about 76%. While the pistils of perfect flowers continued to develop, the pistils of imperfect flowers stopped developing in early December and ultimately disintegrated. The present study used these two types of flower buds from this period, from ‘Daqiandi’ trees grown in the ‘National Field Genebank for Japanese apricot’ (Nanjing, Jiangsu Province, China). All the samples were collected and immediately frozen in liquid nitrogen and stored at −80°C.

              Small RNA library construction and high-throughput sequencing

              In order to construct small RNA libraries, small RNAs were extracted from perfect and imperfect flower buds using a method based on polyethylene glycol (PEG) precipitation combining CTAB buffer [67]. Two small RNA samples were sequenced by the Beijing Genomics Institute (BGI) (Shenzhen, Guangdong Province, China) using the high-throughput pyrosequencing technology developed by Solexa.

              Bioinformatics analysis of sequencing data

              The raw sequences were processed as described by Sunkar et al.[25]. Following removal of the vector sequences, modified sequences from 18 nt to 30 nt were used for further analyses. To begin with, rRNA, tRNA, snRNA, snoRNA and material containing the poly-A tail were removed from the sRNA sequences. The remaining sequences were compared with rice and Arabidopsis ncRNAs deposited in the NCBI GenBank and Rfam10.0 databases. Then, the unique sRNA sequences were used in a BLASTN search of the miRNA database. Only perfectly matched sequences were considered to be conserved miRNAs.

              Potentially novel sequences were identified through alignment with the peach genome sequence on the GDR (http://​www.​rosaceae.​org/​species/​prunus/​peach). Candidate pre-miRNAs were identified by folding the flanking genome sequence of distinct miRNAs using MIREAP [55], followed by a prediction of secondary structure using mFold v3.5 [68]. The criteria chosen for stem-loop hairpins were those described by Meyers et al. and Wang et al.[42, 55].

              Differential expression analyses of miRNAs related to pistil development

              The frequency of miRNAs in the two libraries was normalised to one million by the total number of miRNAs in each sample (normalised expression = actual miRNA count/total count of clean reads*1,000,000). Following normalisation, if the miRNA gene expression of two samples was zero, then it was revised to 0.01; if the miRNA gene expression of two samples was less than 1, owing to their too low expression and did not participate in analysis of differential expression.

              The fold-change between treatment and control was calculated as: fold-change = log2 (imperfect/perfect). The p-value was calculated using the formula below [69, 70], where: N1 and N2 represent the total counts of clean reads of a given miRNA in the sRNA libraries of perfect and imperfect flower bud samples, respectively; and x and y represent the normalised expression levels of a given miRNA in the sRNA libraries of perfect and imperfect flower bud samples, respectively.
              http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-13-371/MediaObjects/12864_2011_4175_Equ1_HTML.gif

              Prediction of potential target mRNAs for Japanese apricot miRNAs

              The rules used for target prediction were based on those suggested by Allen et al.[71] and Schwab et al.[72]. Putative Japanese apricot miRNAs were first blasted against the peach unigene database on the GDR (http://​www.​rosaceae.​org/​species/​prunus/​peach). BLASTN hits possessing less than four mismatches were chosen as candidate targets. BLASTX was then used to obtain their putative functions.

              Validation of miRNAs by poly(A)-tailed qRT-PCR

              The poly(A)-tailed qRT-PCR was carried out as previously reported, with a minor modifications [67, 73]. This could not only detect the existence of Japanese apricot miRNAs, but also their expression trends in various organs and tissues. Small RNAs were extracted from Japanese apricot flower buds as described above and used in a 50-μl reaction system for adding poly(A) tails with poly(A) polymerase (NEB, USA). Reverse transcription was performed using poly(A)-tailed small RNAs from Japanese apricot flower buds, such that 1 μg of small RNA was reverse transcribed to cDNA using MLV reverse transcriptase (Promega, Madison, USA) and looped antisense primers [5′-CCAGTAGCGTATGATGAGCACAGAGTCTGAGATCACTCGTAGCGAGG-d(T)33-V(A/C/G)N(A/C/G/T)-3′]. According to the manufacturer’s instructions, the mix was incubated at 37°C for 40 minutes. qPCR was performed using SYBR® Green Realtime PCR Master Mix (Toyobo, Osaka, Japan). A list of all the primers used is provided in Additional file 4. For each reaction, 1 μL of diluted cDNA (equivalent to 100 pg of total RNA) was mixed with 10 μL of 2X SYBR Green Reaction Mix (SYBR® Green qRT-PCR Master Mix, Takara). A final volume of 20 μL was achieved by the addition of 5 pmol of the forward and the reverse primers. The conditions for the PCR amplification were as follows: polymerase activation at 95°C for 3 minutes, followed by 40 cycles of 95°C for 20 seconds, 60°C for 20 seconds and 72°C for 45 seconds. The fluorescence signal was measured once every 1°C. Negative PCR controls (no cDNA template) were prepared, in order to detect possible contamination. The specificity of the primer amplicons was tested by the analysis of a melting curve. The CT values were converted into relative copy numbers using a standard curve [44]. The 5 S rRNA was used as a reference gene in the qPCR detection of miRNAs in Arabidopsis[56, 74]. The data was analysed with an R2 >0.998 using the LinRegPCR program [75].

              Declarations

              Acknowledgements

              We gratefully acknowledge support of this research by the Special Fund for Agro-scientific Research in the Public Interest of the Ministry of Agriculture of China (201003058), grants from the National Science Foundation of China (31101526) and the Natural Science Foundation of Jiangsu Province (BK2011642), and a project funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD).

              Authors’ Affiliations

              (1)
              College of Horticulture, Nanjing Agricultural University

              References

              1. Chu MY: China fruit records-Mei (in Chinese). China Forestry, Beijing; 1999.
              2. Gao Z, Wang S, Zhang Z: Comparative study on flower and fruit characteristics of 29 varieties in Japanese apricot (Prunus mume Sieb. et Zucc.). Jiangsu Agri Sci 2006, 6:231–233.
              3. Hou J, Gao Z, Wang S, Zhang Z, Chen S, Ando T, Zhang J, Wang X: Isolation and characterization of an AGAMOUS homologue PmAG from the Japanese Apricot (Prunus mume Sieb. et Zucc.). Plant Mol Biol Rep 2011, 29:473–480.View Article
              4. Wang S, Gao Z, Zhang Z, Xu J, Hou J: Comparison of the contents of nitrogen, phosphorus and potassium between perfect and imperfect flowers in Japanese apricot (Prunus mume). J Fruit Sci 2009, 26:564–567.
              5. Montgomery TA, Howell MD, Cuperus JT, Li D, Hansen JE, Alexander AL, Chapman EJ, Fahlgren N, Allen E, Carrington JC: Specificity of ARGONAUTE7-miR390 interaction and dual functionality in TAS3 trans-acting siRNA formation. Cell 2008, 133:128–141.PubMedView Article
              6. Zhu QH, Helliwell CA: Regulation of flowering time and floral patterning by miR172. J Exp Bot 2011, 62:487.PubMedView Article
              7. Nag A, Jack T: Sculpting the flower; the role of microRNAs in flower development. Curr Top Dev Biol 2010, 91:349–378.PubMedView Article
              8. Liu X, Huang J, Wang Y, Khanna K, Xie Z, Owen HA, Zhao D: The role of floral organs in carpels, an Arabidopsis loss-of-function mutation in MicroRNA160a, in organogenesis and the mechanism regulating its expression. Plant J 2010, 62:416–428.PubMedView Article
              9. Lee H, Yoo SJ, Lee JH, Kim W, Yoo SK, Fitzgerald H, Carrington JC, Ahn JH: Genetic framework for flowering-time regulation by ambient temperature-responsive miRNAs in Arabidopsis. Nucleic Acids Res 2010, 38:3081–3093.PubMedView Article
              10. Zhang Y, Cao G, Qu LJ, Gu H: Involvement of an R2R3-MYB transcription factor gene AtMYB118 in embryogenesis in Arabidopsis. Plant Cell Rep 2009, 28:337–346.PubMedView Article
              11. Wang J, Czech B, Weigel D: miR156-regulated SPL transcription factors define an endogenous flowering pathway in Arabidopsis thaliana. Cell 2009, 138:738–749.PubMedView Article
              12. Amiteye S, Corral JM, Vogel H, Sharbel TF: Analysis of conserved microRNAs in floral tissues of sexual and apomictic Boechera species. BMC Genomics 2011, 12:500.PubMedView Article
              13. Wang S: Preliminary studies on differences of related characteristics between perfect flower and imperfect flower and protemics in Japanese apricot. Nanjing Agricultural University, Nanjing; 2008.
              14. Carthew RW, Sontheimer EJ: Origins and mechanisms of miRNAs and siRNAs. Cell 2009, 136:642–655.PubMedView Article
              15. Mallory AC, Vaucheret H: Functions of microRNAs and related small RNAs in plants. Nat Genet 2006, 38:S31-S37.PubMedView Article
              16. Chen C, Ridzon DA, Broomer AJ, Zhou Z, Lee DH, Nguyen JT, Barbisin M, Xu NL, Mahuvakar VR, Andersen MR: Real-time quantification of microRNAs by stem–loop RT–PCR. Nucleic Acids Res 2005, 33:e179.PubMedView Article
              17. Jones-Rhoades MW, Bartel DP, Barte B: MicroRNAs and their regulatory roles in plants. Annu Rev Plant Biol 2006, 57:19–53.PubMedView Article
              18. Bushati N, Cohen SM: MicroRNA functions. Annu Rev Cell Dev Biol 2007, 23:175–205.PubMedView Article
              19. Mette MF, Winden J, Matzke M, Matzke AJM: Short RNAs can identify new candidate transposable element families in Arabidopsis. Plant Physiol 2002, 130:6–9.PubMedView Article
              20. Llave C, Xie Z, Kasschau KD, Carrington JC: Cleavage of scarecrow-like mRNA targets directed by a class of Arabidopsis miRNA. Science 2002, 297:2053.PubMedView Article
              21. Zhang B, Pan X, Cobb GP, Anderson TA: Plant microRNA: a small regulatory molecule with big impact. Dev Biol 2006, 289:3–16.PubMedView Article
              22. Jones-Rhoades MW, Bartel DP, Bartel B: MicroRNAs and their regulatory roles in plants. Annu Rev Plant Biol 2006, 57:19–53.PubMedView Article
              23. Rubio-Somoza I, Weigel D: MicroRNA networks and developmental plasticity in plants. Trends Plant Sci 2011, 16:258–264.PubMedView Article
              24. An FM, Hsiao SR, Chan MT: Sequencing-based approaches reveal low ambient temperature-responsive and tissue-specific microRNAs in Phalaenopsis orchid. PLoS One 2011, 6:e18937.PubMedView Article
              25. Sunkar R, Jagadeeswaran G: In silico identification of conserved microRNAs in large number of diverse plant species. BMC Plant Biol 2008, 8:37.PubMedView Article
              26. Song C, Fang J, Li X, Liu H, Chao CT: Identification and characterization of 27 conserved microRNAs in citrus. Planta 2009, 230:671–685.PubMedView Article
              27. Rajagopalan R, Vaucheret H, Trejo J, Bartel DP: A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana. Genes Dev 2006, 20:3407–3425.PubMedView Article
              28. Fahlgren N, Howell MD, Kasschau KD, Chapman EJ, Sullivan CM, Cumbie JS, Givan SA, Law TF, Grant SR, Dangl JL: High-throughput sequencing of Arabidopsis microRNAs: evidence for frequent birth and death of MIRNA genes. PLoS One 2007, 2:e219.PubMedView Article
              29. Nobuta K, Venu R, Lu C, Beló A, Vemaraju K, Kulkarni K, Wang W, Pillay M, Green PJ, Wang G: An expression atlas of rice mRNAs and small RNAs. Nat Biotechnol 2007, 25:473–477.PubMedView Article
              30. Zhou M, Gu L, Li P, Song X, Wei L, Chen Z, Cao X: Degradome sequencing reveals endogenous small RNA targets in rice (Oryza sativa L. ssp. indica). Front Biol 2010, 5:67–90.View Article
              31. Barakat A, Wall P, DiLoreto S: Conservation and divergence of microRNAs in Populus. BMC Genomics 2007, 8:481.PubMedView Article
              32. Klevebring D, Street N, Fahlgren N, Kasschau K, Carrington J, Lundeberg J, Jansson S: Genome-wide profiling of Populus small RNAs. BMC Genomics 2009, 10:620.PubMedView Article
              33. Lu YD, Gan QH, Chi XY, Qin S: Identification and characterization of microRNAs and their targets in grapevine (Vitis vinifera). Agr Sci China 2008, 7:929–943.View Article
              34. Zhao CZ, Xia H, Frazier TP, Yao YY, Bi YP, Li AQ, Li MJ, Li CS, Zhang BH, Wang XJ: Deep sequencing identifies novel and conserved microRNAs in peanuts (Arachis hypogaea L.). BMC Plant Biol 2010, 10:3.PubMedView Article
              35. Xu Q, Liu Y, Zhu A, Wu X, Ye J, Yu K, Guo W, Deng X: Discovery and comparative profiling of microRNAs in a sweet orange red-flesh mutant and its wild type. BMC Genomics 2010, 11:246.PubMedView Article
              36. Song C, Wang C, Zhang C, Korir N, Yu H, Ma Z, Fang J: Deep sequencing discovery of novel and conserved microRNAs in trifoliate orange (Citrus trifoliata). BMC Genomics 2010, 11:431.PubMedView Article
              37. Wang T, Chen L, Zhao M, Tian Q, Zhang W-H: Identification of drought-responsive microRNAs in Medicago truncatula by genome-wide high-throughput sequencing. BMC Genomics 2011, 12:367.PubMedView Article
              38. Szittya G, Moxon S, Santos DM, Jing R, Fevereiro MPS, Moulton V, Dalmay T: High-throughput sequencing of Medicago truncatula short RNAs identifies eight new miRNA families. BMC Genomics 2008, 9:593.PubMedView Article
              39. Song Q, Liu Y, Hu X, Zhang W, Ma B, Chen S, Zhang J: Identification of miRNAs and their target genes in developing soybean seeds by deep sequencing. BMC Plant Biol 2011, 11:5.PubMedView Article
              40. Martínez G, Forment J, Llave C, Pallás V, Gómez G: High-throughput sequencing, characterization and detection of new and conserved cucumber miRNAs. PLoS One 2011, 6:e19523.PubMedView Article
              41. Yang Y, Chen X, Chen J, Xu H, Li J, Zhang Z: Differential miRNA expression in Rehmannia glutinosa plants subjected to continuous cropping. BMC Plant Biol 2011, 11:53.PubMedView Article
              42. Meyers BC, Axtell MJ, Bartel B, Bartel DP, Baulcombe D, Bowman JL, Cao X, Carrington JC, Chen X, Green PJ, et al.: Criteria for annotation of plant microRNAs. Plant Cell 2008, 20:3186–3190.PubMedView Article
              43. Sunkar R, Zhu JK: Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis. Plant Cell 2004, 16:2001.PubMedView Article
              44. Jones-Rhoades MW, Bartel DP: Computational identification of plant microRNAs and their targets, including a stress-induced miRNA. Mol Cell 2004, 14:787–799.PubMedView Article
              45. Bonnet E, Wuyts J, Rouzé P, Van de Peer Y: Detection of 91 potential conserved plant microRNAs in Arabidopsis thaliana and Oryza sativa identifies important target genes. Proc Natl Acad Sci USA 2004, 101:11511–11516.PubMedView Article
              46. Zhang B, Pan X, Wang Q, Cobb GP, Anderson TA: Identification and characterization of new plant microRNAs using EST analysis. Cell Res 2005, 15:336–360.PubMedView Article
              47. Yu H, Song C, Jia Q, Wang C, Li F, Nicholas KK, Zhang X, Fang J: Computational identification of microRNAs in apple expressed sequence tags and validation of their precise sequences by miR-RACE. Physiol Plant 2011, 141:56–70.PubMedView Article
              48. Moxon S, Jing R, Szittya G, Schwach F, Rusholme Pilcher RL, Moulton V, Dalmay T: Deep sequencing of tomato short RNAs identifies microRNAs targeting genes involved in fruit ripening. Genome Res 2008, 18:1602.PubMedView Article
              49. Pang M, Woodward AW, Agarwal V, Guan X, Ha M, Ramachandran V, Chen X, Triplett BA, Stelly DM, Chen ZJ: Genome-wide analysis reveals rapid and dynamic changes in miRNA and siRNA sequence and expression during ovule and fiber development in allotetraploid cotton (Gossypium hirsutum L.). Genome Biol 2009, 10:R122.PubMedView Article
              50. Huang S, Li R, Zhang Z, Li L, Gu X, Fan W, Lucas WJ, Wang X, Xie B, Ni P: The genome of the cucumber, Cucumis sativus L. Nat Genet 2009, 41:1275–1281.PubMedView Article
              51. Xu M, Liu Q, Nisbet AJ, Cai X, Yan C, Lin R, Yuan Z, Song H, He X, Zhu X: Identification and characterization of microRNAs in Clonorchis sinensis of human health significance. BMC Genomics 2010, 11:521.PubMedView Article
              52. Bartel DP: MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 2004, 116:281–297.PubMedView Article
              53. Yang X, Zhang H, Li L: Global analysis of gene-level microRNA expression in Arabidopsis using deep sequencing data. Genomics 2011, 98:40–46.PubMed
              54. Wang Y, Itaya A, Zhong X, Wu Y, Zhang J, van der Knaap E, Olmstead R, Qi Y, Ding B: Function and evolution of a microRNA that regulates a CaZ + −ATPase and triggers the formation of phased small interfering RNAs in tomato reproductive growth. Plant Cell 2011, 23:3185–3203.PubMedView Article
              55. Wang L, Liu H, Li D, Chen H: Identification and characterization of maize microRNAs involved in the very early stage of seed germination. BMC Genomics 2011, 12:154.PubMedView Article
              56. Wang C, Wang X, Kibet NK, Song C, Zhang C, Li X, Han J, Fang J: Deep sequencing of grapevine flower and berry short RNA library for discovery of novel microRNAs and validation of precise sequences of grapevine microRNAs deposited in miRBase. Physiol Plant 2011, 143:64–81.PubMedView Article
              57. Pantaleo V, Szittya G, Moxon S, Miozzi L, Moulton V, Dalmay T, Burgyan J: Identification of grapevine microRNAs and their targets using high-throughput sequencing and degradome analysis. Plant J 2010, 62:960–976.PubMed
              58. Zhao L, Kim YJ, Dinh TT, Chen X: miR172 regulates stem cell fate and defines the inner boundary of APETALA3 and PISTILLATA expression domain in Arabidopsis floral meristems. Plant J 2007, 51:840–849.PubMedView Article
              59. Ji L, Liu X, Yan J, Wang W, Yumul RE, Kim YJ, Dinh TT, Liu J, Cui X, Zheng B, et al.: ARGONAUTE10 and ARGONAUTE1 regulate the termination of floral stem cells through two microRNAs in Arabidopsis. PLoS Genet 2011, 7:e1001358.PubMedView Article
              60. Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP: MicroRNAs in plants. Genes Dev 2002, 16:1616–1626.PubMedView Article
              61. Licausi F, Weits DA, Pant BD, Scheible WR, Geigenberger P, Van Dongen JT: Hypoxia responsive gene expression is mediated by various subsets of transcription factors and miRNAs that are determined by the actual oxygen availability. New Phytol 2011, 190:442–456.PubMedView Article
              62. Earley K, Smith M, Weber R, Gregory B, Poethig R: An endogenous F-box protein regulates ARGONAUTE1 in Arabidopsis thaliana. Silence 2010, 1:1–10.View Article
              63. Wang L, Hua D, He J, Duan Y, Chen Z, Hong X, Gong Z: Auxin Response Factor2 (ARF2) and its regulated homeodomain gene HB33 mediate abscisic acid response in Arabidopsis. PLoS Genet 2011, 7:e1002172.PubMedView Article
              64. Lim PO, Lee IC, Kim J, Kim HJ, Ryu JS, Woo HR, Nam HG: Auxin response factor 2 (ARF2) plays a major role in regulating auxin-mediated leaf longevity. J Exp Bot 2010, 61:1419–1430.PubMedView Article
              65. Ellis CM, Nagpal P, Young JC, Hagen G, Guilfoyle TJ, Reed JW: AUXIN RESPONSE FACTOR1 and AUXIN RESPONSE FACTOR2 regulate senescence and floral organ abscission in Arabidopsis thaliana. Development 2005, 132:4563–4574.PubMedView Article
              66. Palatnik JF, Wollmann H, Schommer C, Schwab R, Boisbouvier J, Rodriguez R, Warthmann N, Allen E, Dezulian T, Huson D: Sequence and expression differences underlie functional specialization of Arabidopsis microRNAs miR159 and miR319. Dev Cell 2007, 13:115–125.PubMedView Article
              67. Wang X, Xiong A, Yao Q, Zhang Z, Qiao Y: Direct isolation of high-quality low molecular weight RNA of pear peel from the extraction mixture containing nucleic acid. Mol Biotechnol 2009, 44:61–65.PubMedView Article
              68. Zuker M: Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res 2003, 31:3406–3415.PubMedView Article
              69. Jiang P, Wu H, Wang W, Ma W, Sun X, Lu Z: MiPred: classification of real and pseudo microRNA precursors using random forest prediction model with combined features. Nucleic Acids Res 2007, 35:W339-W344.PubMedView Article
              70. Li G, Li Y, Li X, Ning X, Li M, Yang G: MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing. J Cell Biochem 2011, 112:1318–1328.PubMedView Article
              71. Allen E, Xie Z, Gustafson AM, Carrington JC: microRNA-directed phasing during trans-acting siRNA biogenesis in plants. Cell 2005, 121:207–221.PubMedView Article
              72. Schwab R, Palatnik JF, Riester M, Schommer C, Schmid M, Weigel D: Specific effects of microRNAs on the plant transcriptome. Dev Cell 2005, 8:517–527.PubMedView Article
              73. Fujii H, Chiou TJ, Lin SI, Aung K, Zhu JK: A miRNA involved in phosphate-starvation response in Arabidopsis. Curr Biol 2005, 15:2038–2043.PubMedView Article
              74. Shi R, Chiang VL: Facile means for quantifying microRNA expression by real-time PCR. Biotechniques 2005, 39:519–525.PubMedView Article
              75. Ramakers C, Ruijter JM, Deprez RHL, Moorman AFM: Assumption-free analysis of quantitative real-time polymerase chain reaction (PCR) data. Neurosci Lett 2003, 339:62–66.PubMedView Article

              Copyright

              © Gao et al.; licensee BioMed Central Ltd. 2012

              This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://​creativecommons.​org/​licenses/​by/​2.​0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

              Advertisement