A physical map of a BAC clone contig covering the entire autosome insertion between ovine MHC Class IIa and IIb

  • Gang Li1, 2Email author,

    Affiliated with

    • Ka Liu2, 5Email author,

      Affiliated with

      • Shasha Jiao1, 2,

        Affiliated with

        • Haibo Liu2,

          Affiliated with

          • Hugh T Blair3, 4,

            Affiliated with

            • Peng Zhang2, 5,

              Affiliated with

              • Xiaoran Cui2,

                Affiliated with

                • Pingping Tan2,

                  Affiliated with

                  • Jianfeng Gao1, 4Email author and

                    Affiliated with

                    • Runlin Z Ma2, 4, 5, 6Email author

                      Affiliated with

                      BMC Genomics201213:398

                      DOI: 10.1186/1471-2164-13-398

                      Received: 21 January 2012

                      Accepted: 3 August 2012

                      Published: 16 August 2012

                      Abstract

                      Background

                      The ovine Major Histocompatibility Complex (MHC) harbors genes involved in overall resistance/susceptibility of the host to infectious diseases. Compared to human and mouse, the ovine MHC is interrupted by a large piece of autosome insertion via a hypothetical chromosome inversion that constitutes ~25% of ovine chromosome 20. The evolutionary consequence of such an inversion and an insertion (inversion/insertion) in relation to MHC function remains unknown. We previously constructed a BAC clone physical map for the ovine MHC exclusive of the insertion region. Here we report the construction of a high-density physical map covering the autosome insertion in order to address the question of what the inversion/insertion had to do with ruminants during the MHC evolution.

                      Results

                      A total of 119 pairs of comparative bovine oligo primers were utilized to screen an ovine BAC library for positive clones and the orders and overlapping relationships of the identified clones were determined by DNA fingerprinting, BAC-end sequencing, and sequence-specific PCR. A total of 368 positive BAC clones were identified and 108 of the effective clones were ordered into an overlapping BAC contig to cover the consensus region between ovine MHC class IIa and IIb. Therefore, a continuous physical map covering the entire ovine autosome inversion/insertion region was successfully constructed. The map confirmed the bovine sequence assembly for the same homologous region. The DNA sequences of 185 BAC-ends have been deposited into NCBI database with the access numbers HR309252 through HR309068, corresponding to dbGSS ID 30164010 through 30163826.

                      Conclusions

                      We have constructed a high-density BAC clone physical map for the ovine autosome inversion/insertion between the MHC class IIa and IIb. The entire ovine MHC region is now fully covered by a continuous BAC clone contig. The physical map we generated will facilitate MHC functional studies in the ovine, as well as the comparative MHC evolution in ruminants.

                      Keywords

                      Ovine MHC OLA Physical map BAC Comparative mapping

                      Background

                      The mammalian Major Histocompatibility Complex (MHC) harbors genes involved in overall resistance/susceptibility of animals to infectious pathogens, including viral, bacterial, internal and external parasites. Pathogens serve as sources of selection pressure to their host animals, and the hosts are forced to develop effective strategies to fight against the pathogens in various environments. Such co-evolutionary struggles may have left distinct marks in the genome of each species involved, and mammalian MHC regions have been shaped into clusters of immunological gene families by such host-pathogen interactions, probably via functional gene duplications [13]. The implications of ovine MHC molecules in providing protection against pathogens [48] and the associated structures of the artiodactyl’s MHC region in general have led to a number of studies into the sheep MHC [915].

                      The ovine MHC, also called ovine leukocyte antigen (OLA), is located on the long arm of ovine chromosome 20 (OAR 20q15–20q23) with a similar structure and organization to that of human and other mammals [16]. The literature shows that MHC genes play vital roles in resistance of animals to foot rot [17], parasites [9], and bovine leukemia virus [7]. To date, the majority of studies on the structure and organization of the ovine MHC have focused on the gene content and polymorphism of the class II region [1823]. Although most loci in the sheep MHC are found to be homologous to their counterparts in the human MHC [12, 21, 24, 25], there are significant differences. Examples of such differences include the DP loci in human being replaced by DY in sheep [19, 21, 26, 27], and the number of DQA loci varying significantly among sheep breeds [20, 22, 28].

                      Compared to human and mouse, the structure of the sheep MHC is interrupted by a piece of ~14 Mb autosome insertion, possibly via a hypothetical chromosome inversion (inversion/insertion) in the class II region, similar to that of cattle [24, 2932]. The inversion/insertion constitutes ~25% of ovine chromosome 20, which spliced the MHC class II region into IIa and IIb. The significance of such an insertion in relation to the ovine MHC functions remains unknown. The evolutionary consequence of such an event is also worthy of attention, because some of the ovine-specific MHC loci like DY, and Dsb are located near the boundary region of the inversion/insertion. We previously constructed a physical map of BAC clone contigs covering the ovine MHC except the autosome insertion region [12, 13], and a high accuracy sequence map of sheep OLA was accordingly constructed [14].

                      With the initial release of sheep whole genome reference sequences by the International Sheep Genomic Consortium (ISGC), much more genome sequence information is now accessible for functional and comparative studies [33]. Nevertheless, the sequence map would serve the research community even better if it is cross-referenced/checked for accuracy in DNA sequence and assembly, at least for some chromosome regions, by an alternative approach. In this regard, the detailed information is still not fully available for the gene structure, organization, and DNA sequence for the ovine chromosome region between OLA class IIa and IIb [12, 14, 27].

                      In this paper, we describe the construction of a BAC physical map covering the entire autosome insertion between ovine MHC class IIa and IIb. Because ovine and bovine species share the consensus structure and organization in the entire MHC region [24, 2932], we used comparative approaches to screen a sheep BAC library with 119 bovine oligo nucleotide primers designed from the bovine genomic sequences for the consensus region. The order and overlapping relationship of the identified BAC clones were determined by DNA fingerprinting, BAC-end sequencing, and sequence-specific PCR. A total of 108 effective overlapping BAC clones were selected to fully cover the region between class IIa and IIb. The physical map we constructed will help to generate ovine MHC sequencing map with a high level of accuracy, which in turn will facilitate MHC functional and comparative MHC evolution studies in ruminants.

                      Methods

                      Comparative design of oligo primers

                      A BAC library was previously constructed using the genome DNA from a male Chinese merino sheep, with a total of 190,500 BAC clones and an average insert length of 133 kb [12, 13]. To screen the BAC library for positive clones in the target genome region between ovine MHC class IIa and IIb, we adapted a comparative strategy to design bovine oligo nucleotide primers using the bovine reference DNA sequences in the consensus genome region [34]. At the time this study was conducted, no sheep genomic sequence was publicly available for the genome region of our concern. Bovine DNA sequences of homologous genes, exon, intron, or partial STS sequences were acquired from the NCBI website (http://​www.​ncbi.​nlm.​nih.​gov/​genome/​sts/​). Primers were designed along the bovine MHC region between class IIa and IIb, approximately 80–160 kb apart between two neighbor loci using the software Prime Primer 5.0 (Biosoft International, CA). A total of 119 bovine primer pairs were designed for screening the sheep genomic BAC library (Table1).
                      Table 1

                      Comparative bovine primers used for identification of the positive ovine BAC clones in the genome region between MHC Class IIa and IIb *

                      Name

                      Gene symbol

                      Primer sequence (5’→3’)

                      Product(bp)

                      Bovine template sequence

                      Positive Ovine BAC clones

                      S001

                      VPS52

                      F: ATCAATCAGACGATTCCCAACG

                      246

                      UniSTS:279053

                      12 H14;12I12;12 J14; 12 K14;120P21

                        

                      R: ATCAGAAACACAAGCTGCTCCT

                         

                      S002

                      ZBTB22

                      F: TCCTACGACTTACTCCCTCC

                      250

                      UniSTS:66823

                      12I12;12 J14;258 F9; 289 G18

                        

                      R: GGGTCAGGTGGTTGTAGTCT

                         

                      S003

                      KIFC1

                      F: GAGACTGTCCGAGACCTGCT

                      1242

                      UniSTS:BV104878

                      170 G9;217 M14;289 G18

                        

                      R: CTGTGACTACGCGACGAGC

                         

                      S004

                      Loc100139397

                      F: GGTCATCATGGAGGCAGTCT

                      756

                      Exon 6: NC_007324

                      19 H17

                        

                      R: CGTTCTCCTAAGCCATATGC

                         

                      S005

                      BAK1

                      F: CATTGCATGGTGCTAACCGA

                      293

                      Exon 6: NC_007324

                      None

                        

                      R: CAAGCTCAGCCTTCCAGAAC

                         

                      S006

                      IHPK3

                      F: ATGTATGAGAGCTTGGCACG

                      1000

                      UniSTS:267905

                      212D3

                        

                      R: TCAGCTTGTACTCTTCCAGGG

                         

                      S007

                      LEMD2

                      F: ACGTCTACCGCAACAAGCTG

                      227

                      ENSBTAE00000168818: Exon 1

                      None

                        

                      R: GTCTCCGATGTCACCGTAGG

                         

                      S008

                      Loc790333

                      F: GACTGCGAGGTGCCGAAGAA

                      776

                      Exon

                      94 M24;114B22

                        

                      R: GTGGACGGCTACACCTGCAA

                         

                      S009

                      HMGA1

                      F: CTCATGCTCTCATTCGGACA

                      625

                      ENSBTAE00000364012: Exon 6

                      57 M5

                        

                      R: CAGAACAGGAGGCAATGAGG

                         

                      S010

                      NUDT3

                      F: TGAAGTGGAGAGCCTCACAA

                      688

                      ENSBTAE00000213256: Exon 5

                      14E10;300 G8

                        

                      R: CTTCTCAGCAGACGATGGAC

                         

                      S011

                      COX5B

                      F: GTCTCCGTGGTGCGCTCTAT

                      324

                      ENSBTAE00000098033: Exon 1,2

                      130 G21;130 M2;170 K16

                        

                      R: GGTGTGGCACCAGCTTGTAA

                         

                      S012

                      PACSIN1

                      F: AAGCCAGCAACAGTAGCAGC

                      683

                      ENSBTAE00000336066: Exon 10

                      253I24

                        

                      R: TCGTTACCTGGAGACCAAGC

                         

                      S013

                      C6orf106

                      F: AGTGAGCGGCTGAGAGAGTT

                      266

                      ENSBTAT00000048861: Exon 1

                      None

                        

                      R: AACTCGGAGATGAGCACGTC

                         

                      S014

                      SNRPC

                      F: CCAATGATGAGACCTCCTGC

                      147

                      ENSBTAT00000034155:Exon 6

                      119P19;157 K19;223 N7; 227 J17;232 G24

                        

                      R: CAGAGTCACAGCACCATGAT

                         

                      S015

                      TAF11

                      F: TGGATGTGTGTGAGAAGTGG

                      561

                      ENSBTAT00000022463: Exon 5

                      194 L19;215 J4;232 G24;234C5

                        

                      R: TCATGGTGGAGTATCACAGG

                         

                      S016

                      ANKS1A

                      F: CGAGGAATGGCCACAAAG

                      894

                      UniSTS:BV105378

                      124P23;320A1

                        

                      R: ATCGGTCTTGCCAAACAAAG

                         

                      S017

                      TCP11

                      F: ATCAGCGGATCCACTTGTTC

                      373

                      ENSBTAT00000022467: Exon 11

                      24D11

                        

                      R: CTGGAGCTCACACACGAGGT

                         

                      S018

                      DEF6

                      F: ACCACCAGCAGCTCCTTCAC

                      496

                      ENSBTAT00000036152: Exon 11

                      21 M13;66I6;124 K16; 193E6;206 L10

                        

                      R: CCTGGCTTGCTTGTTGACTC

                         

                      S019

                      PPARD

                      F: GTTCCATGGTCACCTTCTCC

                      353

                      ENSBTAT00000023319: Exon 8

                      28D20;152A4

                        

                      R: CCGTGAATCTCGCTTCTCTT

                         

                      S020

                      TEAD3

                      F: CCCATCACAGCTGGATTTTA

                      145

                      UniSTS:180986

                      None

                        

                      R: AAATGAAGTACTGTGCCCCC

                         

                      S021

                      Loc540812

                      F: TGCACTGCAACTTCCTGAAC

                      263

                      Exon

                      95D10;119O20;158O6

                        

                      R: GCACTGCAGGCTGACTATGA

                         

                      S022

                      SRPK1

                      F: CAGACACTTACAGGACGTGG

                      273

                      ENSBTAT00000022396: Exon 11

                      269D12;285I5

                        

                      R: TGAAGACTGGCACATCATGG

                         

                      S023

                      SLC26A8

                      F: ACATCAGCACCGTCAGTCACC

                      222

                      UniSTS:476830

                      26A21;121O15

                        

                      R: AGGCGATAGAGGACAAACCACAC

                         

                      S024

                      MAPK14

                      F: GAATGGATAACAAAACACTT

                      196

                      UniSTS:279403

                      26A21;121O15

                        

                      R: AGGCGATAGAGGACAAACCACAC

                         

                      S025

                      MAPK13

                      F: AGAAGCTCAATGACAAGGCG

                      606

                      UniSTS:269171

                      121O15;154 M16

                        

                      R: TTCCATTCGTCCACTGTGAG

                         

                      S026

                      BRPF3

                      F: GACGCCTGCATCGTATTAGC

                      575

                      ENSBTAT00000017711: Exon 1

                      154 M16;250 L24; 278B11;281D9;300 J5

                        

                      R: AGCCAGGTTGCAGATGTCAC

                         

                      S027

                      PNPLA1

                      F: TCCTGAACGCTGTCAACCGA

                      449

                      ENSBTAT00000055658: Exon 7

                      78 M7;153 F9;268E18; 319O4;337 K13

                        

                      R: CAGGTGGCTGTGCAGGTGAT

                         

                      S028

                      Loc790226

                      F: CCATGACTCCGTAGACAAGA

                      483

                      Exon

                      3O16;9 G2;9 G3;9 H8; 10 N2;15B13;26D1

                        

                      R: ACTGCCATAGCTACTGCTGC

                         

                      S029

                      KCTD20

                      F: CGATGCAATCACTAAGCTGG

                      834

                      ENSBTAT00000027439: Exon 8

                      None

                        

                      R: GCAGTTCTCATCCTTCGCAC

                         

                      S030

                      RPS4Y1

                      F: TGCCAGCCTCTTGTCTCTCT

                      430

                      ENSBTAT00000036142: Exon 2

                      2A3;11 H24;63 N7; 82 N20;97O2;120P24

                        

                      R: TACACCTGAGGAGGCCAAGT

                         

                      S031

                      CDKN1A

                      F: GGATCGCTAAGAGCCGGACA

                      861

                      ENSBTAT00000011001: Exon 3

                      None

                        

                      R: GGCAGTCGCTGCTTGAGGTA

                         

                      S032

                      PPIL1

                      F: AATGGTCAATGCGCCTGCTT

                      888

                      ENSBTAT00000003071: Exon 4

                      30O17;139 K9;198 M20;271C5

                        

                      R: CACCAACGGCAGCCAGTTCT

                         

                      S033

                      PI16

                      F: CCTAGCAACAGAAGCCTCAA

                      461

                      ENSBTAT00000002703: Exon 5

                      54O24

                        

                      R: AGGCCAAGATCTCACTGCAA

                         

                      S034

                      FGD2

                      F: CACCTTGGTGACCAACATTC

                      414

                      ENSBTAT00000018834: Exon 16

                      304 K7;318I17

                        

                      R: ACTGCCATAGCTACTGCTGC

                         

                      S035

                      PIM1

                      F: AAGCACGTGGAGAAGGACCG

                      490

                      UniSTS:463218

                      None

                        

                      R: GACTGTGTCCTTGAGCAGCG

                         

                      S036

                      TBC1D22B

                      F: CTGTCCACCACTCCATGTCT

                      539

                      ENSBTAT00000018938: Exon 13

                      5 K4;26A20;49B1;98 G9

                        

                      R: GGACATTCGGACGTGTAACT

                         

                      S037

                      RNF8

                      F: TCTGAATGGTGTCTGGCTGA

                      708

                      ENSBTAT00000010959: Exon 3

                      None

                        

                      R: TTCTCGAGCTGCTCCACTCT

                         

                      S038

                      Loc509620

                      F: AGTGGCACACCGAAGCTC

                      666

                      UniSTS:267349

                      25P1;103D16;207 L11; 271 M7

                        

                      R: AACTTCCTCTTGAAGCTTTTGC

                         

                      S039

                      C23H6orf129

                      F: GGCAAGAGAACCGCAAGAAC

                      281

                      ENSBTAT00000016009: Exon 4

                      25P1;103D16

                        

                      R: GCACGAAGTCCTTCTGGAGC

                         

                      S040

                      MDGA1

                      F: TCTTGGCGTTGCAGAGATGA

                      228

                      ENSBTAT00000047505: Exon 16

                      None

                        

                      R: TGTGCGTGTGTCGAACAACC

                         

                      S041

                      ZFAND3

                      F: CGATTGGTTTAATTTTTTTTTTCA

                      200

                      UniSTS:34520

                      159 K21;185 L24;235B3

                        

                      R: TGTGAAGTTTGTTAAATGTAAGGAA

                         

                      S042

                      BTBD9

                      F: GATAGGTCTTACGCTGTTAG

                      155

                      UniSTS:279369

                      None

                        

                      R: GAATGTACAGAATAGAAGTG

                         

                      S043

                      Loc781915

                      F: AACCTCAAGTGCCTCTCCAG

                      714

                      Exon

                      67D11;70 N21;76E1; 240 K15;240O16

                        

                      R: AACAAGTGTAGCCAGCCATC

                         

                      S044

                      GL01

                      F: GATAGGTCTTACGCTGTTAG

                      155

                      UniSTS:279369

                      None

                        

                      R: GAATGTACAGAATAGAAGTG

                         

                      S045

                      Loc525414

                      F: GAAGAAGAGGTGATCGGTGTAGAG

                      216

                      UniSTS:476833

                      8 J2;13E21;24 K16; 24 N15;28 L5;112 N3

                        

                      R: TTTCTCCTTCCCATACATTTCTGTG

                         

                      S045b

                      GLP1R

                      F: CGAGTGTGAGGATTCCAAGC

                      418

                      Exon 4, 5 and intron

                      80 G15;138P3

                        

                      R: GTAGCCCACCGTGTAGATGA

                         

                      S046

                      C23H6orf64

                      F: GTCACAGCCACCATGGAGTC

                      415

                      ENSBTAT00000001425: Exon 2

                      19 F4;80 G15;138P3; 156B12; 336 L24

                        

                      R: CGCAAGCTGTTCTCAGTCAA

                         

                      S047

                      KCNK5

                      F: CTCCGACTCTGTGCTGGTGA

                      774

                      ENSBTAT00000014756: Exon 5

                      None

                        

                      R: TACCACGCCTTGTACCGCTA

                         

                      S048

                      KCNK17

                      F: AGAGTCCAGGCTCCTTCTAT

                      493

                      ENSBTAT00000013646: Exon 5

                      None

                        

                      R: CTGCTATCCTCAGAGTTCCA

                         

                      S049

                      Loc100139627

                      F: GTGGAGGGAACCTGCGGCAC

                      344

                      NC_007324.3: designed online

                      3 L3;51O8;189 L22; 253I5; 270 L14

                        

                      R: AGGCCTCGGAAGAGCCCTGG

                         

                      S050

                      Loc100138924

                      F: CTTGGTCTTGCGGGCCCCTG

                      493

                      NC_007324.3: designed online

                      145 G9;146 H11

                        

                      R: CCAGGCTCTAGCCCTGCCCA

                         

                      S051

                      DAAM2

                      F: CAGGGAGTGCTCTCAAAGGTAAAGG

                      307

                      UniSTS:476834

                      None

                        

                      R: TCCTCCAGCCTGACTTCTCCTTC

                         

                      S052

                      MOCS1

                      F: GGTCCAGGAAGGCTGAAGTG

                      661

                      ENSBTAT00000013792: Exon 11

                      None

                        

                      R: GAAGGACGGATGGCTATGGT

                         

                      S053

                      LRFN2

                      F: TTGTCATACACGGCGGTCCT

                      493

                      ENSBTAT00000023907: Exon 1

                      77E2;220 J8;325 J12; 325 J13

                        

                      R: AGCTGAGCCTCGACCACAAC

                         

                      S054

                      UNC5CL

                      F: TGACCAACGAGCAGCCACAC

                      278

                      UniSTS:476835

                      None

                        

                      R: GCAGCAGGAGGAGCCAGAAG

                         

                      S055

                      NFYA

                      F: GCCGATGAAGAAGCTATGAC

                      550

                      ENSBTAT00000013080: Exon 10

                      76 K24;118P22;136B19

                        

                      R: CATGAGATGGAGCTTCCTTG

                         

                      S056

                      TREM2

                      F: ACAACTCCTTGAAGCACTGG

                      229

                      ENSBTAT00000009568: Exon 2

                      86A4;178 L4;208 M19; 282 F4

                        

                      R: TGGAGGCTCTGGCACTGGTA

                         

                      S057

                      TREM1

                      F: CATCATTCCTGCAGCATGTG

                      515

                      ENSBTAT00000023397: Exon 4

                      30C8;73 K17;75A11; 75I21

                        

                      R: GGCTGTGCCAGGTCTTAGTT

                         

                      S058

                      LOC783024

                      F: CTGAGGACCAAGGCCATGCT

                      216

                      Exon

                      None

                        

                      R: TGGTGTGGCACTGCAGGAAG

                         

                      S059

                      FOXP4

                      F: AATTATCGCTCCAAGAGATTCCAC

                      250

                      UniSTS:384935

                      112I1;144 K17;181 F9; 299P14;314 F18

                        

                      R: CCCATCCTTGTCTCCTCTTTACAT

                         

                      S060

                      MDFI

                      F: GCTGTGTCCACTGCATCTTG

                      256

                      ENSBTAT00000025763: Exon 4

                      70B14;166C6;181 J11; 202B12; 229A10

                        

                      R: GGTCAGGAGGAGAAGCAGAG

                         

                      S061

                      PGC

                      F: GAAATTCTCTGCTAAACCCCTTCA

                      268

                      UniSTS:385581

                      14 G18;24O7;24O10; 103 G9; 139 N14

                        

                      R: TCATCTAAGCAGAAACACCAGTAAATG

                         

                      S062

                      USP49

                      F: GATGGAGTTCATGTAGCAGGTGTT

                      260

                      UniSTS:385828

                      None

                        

                      R: GGAGCGCAAGAAGGAGGAG

                         

                      S063

                      BYSL

                      F: TCAGAGGACCTGGAAGTGGA

                      538

                      ENSBTAT00000013326: Exon 7

                      3 M12;98 J10;182 F10

                        

                      R: CTCTCATGCACAGCAGTGGA

                         

                      S064

                      TAF8

                      F: TGGAGGAAGGAACTTGGTCACAGAG

                      228

                      UniSTS:476836

                      103 M11;133 J10;146 L22

                        

                      R: GGTGCTTGAGGTTCGTTGAGTTGAG

                         

                      S065

                      MGC137036

                      F: GAAGCAGGACCGTGAGCAGA

                      238

                      ENSBTAT00000017035: Exon 2

                      100O15;117E7;133 J9; 146 L22;171 L22;176P6

                        

                      R: CTACGAGCGCCACAAGACCA

                         

                      S066

                      TRERF1

                      F: GTGTGTCTGTTGCTGCGGTG

                      643

                      ENSBTAT00000020376: Exon 1

                      1O22;17 J12;79 H15; 81 J21;100O15;259 L15

                        

                      R: TGGTCTAGGCTTGGCTGTTG

                         

                      S067

                      Loc786000

                      F: TGGCAAGATGGCGGTGCCAG

                      379

                      NC_007324.3: designed online

                      6P21;32P14;142C8; 162E5;195C23;227D22

                        

                      R: AGCAGCCTTGGCCCCACTCT

                         

                      S068

                      UBR2

                      F: CTGCAAGCAACTGACCTCAC

                      169

                      ENSBTAT00000007833: Exon 2

                      6P21;129B6;162E5; 163E23;177 M6

                        

                      R: CCAACTCAGGATCTTCACCA

                         

                      S069

                      PRPH2

                      F: GTAGTGGACTCCAGGAACTTCG

                      232

                      UniSTS:279013

                      26 J6;26 L8;29 M14; 127A7;134B12;177A2

                        

                      R: ACCACAGAGTCACCTGCTGAGA

                         

                      S070

                      Loc540169

                      F: ATGAAAGGGTCAGGCGAAC

                      130

                      UniSTS:94727

                      144A13;164 L3;164 M2;164 M3;172O18;185 N10

                        

                      R: ACAGAGCCGCTAACCGTG

                         

                      S071

                      CNPY3

                      F: GAACAGTGGTCTGGCAAGAA

                      214

                      ENSBTAT00000021132: Exon 10

                      98 J16;172O18;185 N10;189O8;289 J21

                        

                      R: GTTAGGCTCAGAGCTCGTCA

                         

                      S072

                      CUL7

                      F: TTTCGACCTCGCTCTGAGTT

                      1,000

                      UniSTS:270008

                      74C2;189O8;289 J21; 325 K12

                        

                      R: CTCCAGCATGTGCCAGTG

                         

                      S073

                      PTK7

                      F: GACTCAGGAGCCTTCCAGTG

                      531

                      UniSTS:268417

                      54A6;127D14;142 L8; 163O23;204P7

                        

                      R: CTGTATTGCAGCTTCCGAGG

                         

                      S074

                      Loc540077

                      F: CTGAATACCTGATCCGATGG

                      417

                      Exon

                      54A6;142 L8;163O23; 204P7

                        

                      R: GCATGTGCATGAGTAGGTCC

                         

                      S075

                      Loc786439

                      F: GGCGTCTTTAATCAGGATTTGG

                      200

                      UniSTS:222501

                      None

                        

                      R: AATCCAACACTTGAAACCGACA

                         

                      S076

                      ZNF318

                      F: CTGTCTTCACTCGAAGCTCC

                      438

                      ENSBTAT00000013481: Exon 1

                      24 L23;66 G8;83 N5; 119 J9;162 F10

                        

                      R: AGCTCCTACTTCGTTCCTCC

                         

                      S077

                      TJAP1

                      F: GAGGACGAGGAAGAGCTGAA

                      654

                      ENSBTAT00000035977: Exon 12

                      None

                        

                      R: CGTGCAGAGGATTGAAGGAG

                         

                      S078

                      POLH

                      F: GACAGCCACACACATAAGCA

                      497

                      ENSBTAT00000007900: Exon 11

                      68 F17;71 H18;74P6; 124 L6;250 J4

                        

                      R: GTCTCACAGAGTCGGACACG

                         

                      S079

                      MRPS18A

                      F: AGTCGTGAGACCACTGCAGC

                      191

                      ENSBTAT00000056429: Exon 6

                      115P10;176 M14; 233 H10;278 K6;291I13

                        

                      R: AGGACCTCCTGAGAGCCTGA

                         

                      S080

                      VEGFA

                      F: GATCATGCGGATCAAACCTCACC

                      326

                      UniSTS:471318

                      12B17;12 H11;30 L7; 63B18;124 J8;249D14

                        

                      R: CCTCCGGACCCAAAGTGCTC

                         

                      S081

                      MRPL14

                      F: TCAGAACTGCTCCATTCACG

                      182

                      UniSTS:64809

                      117 J15

                        

                      R: CAACAACGTGGTCCTCATTG

                         

                      S082

                      SLC29A1

                      F: GGTGGTCTTTGAGCACGACT

                      537

                      UniSTS:207086

                      None

                        

                      R: CCGGAACAGGAAGGAGAAG

                         

                      S083

                      AARS2

                      F: CACTGGAAGCACTGCTGACC

                      325

                      ENSBTAT00000018232: Exon 22

                      None

                        

                      R: GCAGCCAGAACAGCCATGTA

                         

                      S084

                      CDC5L

                      F: CCAACTCAGTGGAGGACCAT

                      750

                      UniSTS:267825

                      134E15;147I12

                        

                      R: GGCTTTGTTTCTGGATTTGG

                         

                      S085

                      SUPT3H

                      F: CTTCTGCCTGGAACTTGCACTTG

                      208

                      UniSTS:476839

                      23P23;80P15;110 F4;5;6

                        

                      R: TGCTTACTGTCTCCCACCTAGATTG

                         

                      S086

                      Loc536911

                      F: TACCAGCCACCGAGACCAA

                      309

                      UniSTS:280406

                      9 G19;9 H22;9I23;24; 59B8

                        

                      R: AGAGGCTGTTTGACGCCATAG

                         

                      S086b

                      CLIC5(BM1258)

                      F: GTATGTATTTTTCCCACCCTGC

                      158

                      UniSTS:56663

                      291I15

                        

                      R: GAGTCAGACATGACTGAGCCTG

                         

                      S087

                      ENPP4

                      F: GAACCAGCTCACCAATGTGT

                      595

                      ENSBTAT00000004547: Exon 2

                      72 M13;74O6;127 F7; 182 K12;299 N7

                        

                      R: TCCTCTGCTTCACCACCTAA

                         

                      S088

                      RCAN2

                      F: TCTTTACTGTCTGAGCCACC

                      132

                      UniSTS:69107

                      None

                        

                      R: TACACTCAGAGCTAGTTTGC

                         

                      S089

                      CYP39A1

                      F: AGGTGATGGTGGCAACTATG

                      200

                      UniSTS:15671

                      57E15;181B7;202D23; 213A17;261 M4

                        

                      R: CATGTGTCCATAATTTGATTGC

                         

                      S090

                      TDRD6

                      F: GAGTTCTTCCACCTGCCGTC

                      490

                      ENSBTAT00000013158: Exon 1

                      114B7;147E14;190 N9; 329 H12;350E16

                        

                      R: ATACCTGAGCCATGCTCTCG

                         

                      S091

                      Loc785478

                      F: TACGCCACCTACACACACAC

                      439

                      Exon

                      65 L20;133 M1;211 N8; 233B22;233O14

                        

                      R: GACTGGTAGCTCCTGATCTG

                         

                      S092

                      GPR116

                      F: CACATCCAGTGCTTATTCAT

                      302

                      ENSBTAT00000035930: Exon 18

                      291 M9

                        

                      R: TAGACAGAGAAGTTGGCTTG

                         

                      S093

                      GPR110

                      F: AGTGGACAGATACCGGCTGC

                      452

                      ENSBTAT00000028795: Exon 10

                      None

                        

                      R: AGGTGTGGCCATGTGATGGA

                         

                      S094

                      TNFRSF21

                      F: CAGAGCAGAAGGCACCAAGT

                      500

                      ENSBTAT00000047874: Exon 11

                      118P16;351 H10

                        

                      R: ATTGTCTGCCTCCTTGGTCC

                         

                      S095

                      LOC785024

                      F: GGTTGTCAAGCCACTCGAAT

                      611

                      Exon

                      14B7;79 L8;168 N8; 264 L6

                        

                      R: CGGAGTATATGGCCAGTGTT

                         

                      S096

                      LOC512926

                      F: AGAGCAGAAGGCACCAAGTC

                      437

                      Exon

                      27A8;290 J19;351 H10

                        

                      R: ACGCTCTGCATCTCATCACA

                         

                      S097

                      CD2AP

                      F: TACCACAACACCAACTGCAT

                      309

                      UniSTS:278169

                      1 H10;14A2;75 J19; 114B12;151 J21;166 L22

                        

                      R: TTACCGGGATCACAGAAACA

                         

                      S098

                      GPR115

                      F: CACAGTGGTGGCAGCAATAA

                      490

                      ENSBTAT00000003815: Exon 5

                      None

                        

                      R: GAATAGAGTGCAATGCCGGT

                         

                      S099

                      OPN5

                      F: CTACATCTGCCTGGCGGTCA

                      287

                      ENSBTAT00000021933: Exon 4

                      167I8;228 M7

                        

                      R: CATGGCTGCTATGGATCCGA

                         

                      S100

                      MGC148542

                      F: ACATTTTCTCCTTCTTTGGCTCC

                      272

                      UniSTS:133880

                      1A19;1B9;140A1; 216D18;319I16

                        

                      R: GATAGAGGATGACGACAAATGGC

                         

                      S101

                      Loc785693

                      F: AGCCAGGTAGAGTTCCAATG

                      518

                      Exon

                      17 K13;75E1;76B22; 103 F21

                        

                      R: AGTCTCGGCAGTTACCTTGA

                         

                      S102

                      MUT

                      F: AGCAAAGCACATGCCAAAAT

                      750

                      UniSTS:279392

                      74 J7;8;86P12;252B10; 255 G2;266O16;313 L2

                        

                      R: TTCCCCAGAAGAAAGACAAC

                         

                      S103

                      Loc787783

                      F: GGAATCATCAACCCAGTGAGAAAGC

                      269

                      UniSTS:476844

                      255 G2;266O16;274D6; 288I23

                        

                      R: CACACGGCGGCAGAAAGAGG

                         

                      S104

                      RHAG

                      F: GAATCGATGACCATCCATGC

                      470

                      ENSBTAT00000015012: Exon 4,5

                      53D7;173C22;186 L10; 226 G3;4;226 H7

                        

                      R: AGAAGGCTGGAACATGCGTA

                         

                      S105

                      Loc100138627

                      F: AATGAATAGTATCCCCAATACCTGC

                      150

                      UniSTS:164033

                      None

                        

                      R: GTCCACAAAACATTCTCCTTTCC

                         

                      S106

                      TFAP2D

                      F: TAAGCTTTCGGAGAAACCCA

                      1422

                      UniSTS:482175

                      5 K4; 139 L18;230 K5

                        

                      R: CAGCAGCAAGACTCTCTGGA

                         

                      S107

                      TFAP2B

                      F: TGCATGCTCCCTCCTCTC

                      120

                      UniSTS:71657

                      25D11;25 F24;142E22; 161A23;167 J23;189D14

                        

                      R: CCTCGTCCAATTATGGTGCT

                         

                      S108

                      Loc100138859

                      F: GGAGCACCACAGTACGTAAG

                      561

                      Exon

                      None

                        

                      R: GAGGTGTGCCTGTATTGCTA

                         

                      S109

                      Loc537895

                      F: TTCTCTCAAATGATGAATATGCTTC

                      270

                      UniSTS:251053

                      56 J7;86O3;87 H23; 277 G10;277 H11

                        

                      R: GGACTATTCTATGCATGCCTCTC

                         

                      S110

                      IL17A

                      F: CACTCAGGCTGTATCAATGC

                      591

                      ENSBTAT00000002786: Exon 3

                      13B24;74A7;74E17; 164 H22;164I23

                        

                      R: CAGCTGTGTCATGTACTCCA

                         

                      S111

                      MCM3

                      F: TGTCCCGATTTGACCTTCTC

                      515

                      UniSTS:268664

                      69 G8;168E20;223C7; 263 M23;270P6

                        

                      R: GTCATCAGGGCTGAAGTTGG

                         

                      S112

                      PAQR8

                      F: TCTATGTCCTGTCCTCCATC

                      447

                      ENSBTAT00000035844: Exon 2

                      102 M1;160 L10

                        

                      R: AGAAGAAGTAGGCACTGACC

                         

                      S113

                      TRAM2

                      F: TGTTCTACATCTTCATCGCCA

                      630

                      UniSTS:267311

                      13P23;53 J18;92C23

                        

                      R: ACCAGATCACCGAGCTGAGA

                         

                      S114

                      TMEM14A

                      F: CTACCCAAGAAACACTGTCGC

                      286

                      ENSBTAT00000006857: Exon 6

                      2C18;31C1;139B24; 183A23;280 K17

                        

                      R: AGAGCATTCTATGAAGCCCG

                         

                      S115

                      ICK

                      F: ACGGACTGGATCGCTAAGTA

                      627

                      ENSBTAT00000020711: Exon 14

                      2C18;76A8;77 G6; 198C12;199 K7

                        

                      R: CAGAACAGCACAGCGGTATT

                         

                      S116

                      GCM1

                      F: AGCTGTCCAACTGCCTCCTG

                      363

                      ENSBTAT00000010709: Exon 6

                      141A15;199 K7;230E24; 314I2

                        

                      R: TGGGAAGGGGAGAAGTCGTA

                         

                      S117

                      ELOVL5

                      F: CTACAGCCACGAGACAGTTT

                      182

                      UniSTS:279336

                      64 N21;82O21;90C20; 127 J19;163 F13

                        

                      R: GGTTTCAATCATTCTTTCAT

                         

                      * The bovine oligo primers were designed along the target bovine genomic sequence at an interval of ~80-160 kb between the two neighbor loci, depending on the availability of the DNA sequence that meet the primer selection criteria. A total of 119 pairs of primers were listed here.

                      BAC library organization and screening

                      To facilitate large scale PCR screening, all the 190,500 clones of the BAC library were organized into 3-dimensional BAC clone pools of plates, rows, and columns. Random BAC clones from each of 496 permanent 384-well storage plates were duplicated onto a Luria-Bertani (LB) agar plate for overnight growth at 37°C, using a 384-pin Multi-Blot Replicator as tool for BAC clone duplication (V & P Scientific, Inc., San Diego, CA). The overnight E. coli colonies were then harvested and pooled for plate (n = 496), row (n = 16), or column (n = 24). The standard alkaline lyses methodology was adapted for isolation of the pooled BAC plasmid DNA and the resulting DNA was assembled into super plates for routine PCR screening [35]. The first dimension of the BAC clone pool consisted of 496 DNA samples, each representing one of 496 BAC plates (P001-P496). The second and third dimension consisted of 16 and 24 DNA samples, respectively, for the pooled 16 rows (R01-R16) and 24 columns (C01-C24) of the random BAC clones.

                      To screen the BAC library using each of 119 pairs of comparative oligo primer pairs, the diluted DNA from each well of the super pool plates was used as a DNA template. The individual PCR reaction was adapted in a total of 10 μl reaction volume with 50 μM of dNTPs, 1.5 mM Mg++, 0.2 μM of each primer pair, 1 × PCR buffer, and 0.1 unit of Tag DNA polymerase. The PCR products were resolved by 1.5% agarose gel electrophoresis and the specific PCR fragment band with the expected size indicated a potential positive BAC clone for the gene loci of oligo primers used. The exact location of the target clone in the BAC library was determined by sequential PCRs using the super row and super column DNA as templates, respectively.

                      DNA fingerprinting and contig assembling

                      DNA fingerprinting was performed to determine the overlapping relationship among the identified positive BAC clones [12]. DNA from the positive BAC clone was purified from host E. coli by QIAGEN column and subjected for complete restriction enzyme digestion using HindIII. The enzyme digested products were analyzed on 1% TAE agarose gel electrophoresis for recoding of DNA fragment patterns. The fingerprinting images were captured with UVP Labworks System (UVP Inc., Upland, CA) for systematic analysis. Restriction fragment patterns were analyzed to identify overlapping BAC clones, which were then manually assembled into draft contigs based on the modified methods of Marra [36] and Soderlund [37].

                      BAC-end sequencing

                      BAC-end sequencing was performed for the selected clones to facilitate verification of the overlapping relationships of the BAC clones. The sequencing was performed on an ABI 3730X DNA analyzer at the core facilities of the Institute of Genetics and Developmental Biology, the Chinese Academy of Sciences. The oligo nucleotide primers used for the DNA sequencing were Copycontrol pCC1BAC vector-derived sequencing primer T7 (5’-TAATACGACTCACTATAGGG3’), pCC1/pEpiFOS RP-2 (abbr. RP2) (5’-TACGCCAAGCTATTTAGGTGAGA-3’), and pCC1/pEpiFOS RP-1(abbr. RP-1) (5'-CTCGTATGTTGTGTGGAATTGTGAGC-3'). The resulting sequences were analyzed for overlapping, and used as templates for oligo primer design. Based on the sequence data generated by BAC-end sequencing, PCR primers (Additional file 1: Table S1) were designed to amplify the common genetic loci in two overlapped BACs for confirmation. Sequence-Specific PCRs (SP-PCRs) were performed in 20 μl system including approximately 2 ng BAC DNA, 0.5 U Taq DNA polymerase, 0.1 mM dNTPs, 1.5 mM Mg++, 0.25 μM each primer, and 1× PCR buffer. When necessary, the PCR products were verified by cloning the fragments into a TA vector for verifying DNA sequencing.

                      Assemble of the BAC clone contig

                      A continuous BAC clone contig was eventually assembled based on the integrated results of DNA fingerprinting, BAC-end sequencing, and sequence specific PCR amplification of the common loci on the overlapping clones. Redundant BAC clones were removed from the assembly based on the necessity and the relative contribution of each overlapping BACs on the contig. Gaps in the contig were closed by the repeated cycles of PCR screening of BAC clones, DNA fingerprinting of additional BAC clones identified, BAC-end sequencing, and SP-PCR verification. Additional effort was made to link the existing BAC clone contig to the physical map constructed previously, for a complete physical map covering the entire ovine MHC including the autosome insertion between class IIa and IIb.

                      For comparison of the MHC structure and organization between sheep and other mammals, multiple comparisons were performed for the representative MHC and extended DNA sequences from human, chimpanzees, mouse, cattle, and sheep. Sequence data were downloaded from the NCBI database and other related public websites designated for the sheep genomic information.

                      Results

                      Target BAC identification

                      We successfully identified a total of 368 positive BAC clones for ovine chromosome 20 between MHC class IIa and IIb, utilizing bovine primers designed from the consensus genome region (Table1). Out of 119 pairs of oligo primers designed, 92 pairs worked effectively to generate specific target gene fragments of the expected sizes. This approach resulted in the successful identification of positive ovine BAC clones in the target genome region, and the overall efficiency of comparative PCR reached 80%. The relatively high rate of success for the comparative SP-PCR not only facilitated our mapping efforts, but also helped to confirm the homologous nature of MHC regions between bovine and ovine species.

                      Organization of ~190,500 random ovine BAC clones into three dimensional super DNA pool of rows (n = 16), columns (n = 24), and plates (n = 496) significantly increased the efficiency of PCR screening of the sheep BAC library (Figure1). The whole BAC library of 8.4× genome equivalents was screened through with a maximum of 536 (=496 + 16 + 24) PCR reactions, and a positive BAC clone could be frequently identified by as few as 136 (=96 + 16 + 24) PCR reactions using the super pool DNA as templates. In addition, PCR-based BAC clone screening also helped to eliminate the need for hybridization-based screening using radioactive 32P labeling.
                      http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-13-398/MediaObjects/12864_2012_4266_Fig1_HTML.jpg
                      Figure 1

                      Representative gel images on initial PCR screening of an ovine BAC library using comparative primers from the bovine sequences. Approximately 190,500 random BAC clones were organized into pooled super DNA plates of rows, columns, and plates to facilitate PCR screening. Location of a target positive BAC clone in the library was determined usually by two runs of PCRs, one for “plate” and the other for “row + column”. The procedure eliminated the need for hybridization-based screening with radioactive 32P labeling. Gel images of PCR screen band on (A): Row pool of P098 BAC plate using the primer pair S036; (B): Row pool of P056 BAC plate using the primer pair S109; (C): Row N of P083 BAC plate; (D): Row F of P162 BAC plate. M: DL2000. Sample: PCR Products. A ~ P: Number of Row. 1 ~ 16: Number of Column (only partial shown here). P: Positive control (The amplified PCR products using the sheep genome DNA as templates).

                      DNA fingerprinting and BAC-end sequencing

                      The initial order of the positive BAC clones identified was successfully determined by inferring the overlapping relationships among the clones via DNA fingerprinting, using HindIII for restriction enzyme digestion of the BAC clone DNAs (Figure2). Out of 368 positive BAC clones subjected for the DNA fingerprinting, 185 clones with their overlapping relationships were successfully determined. The resulting BAC contig covered the entire autosome insertion region between the MHC class IIa and IIb. After removing the redundant clones, a total of 108 effective BACs were ordered to form an overlapping BAC contig (Additional file 1: Table S1).
                      http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-13-398/MediaObjects/12864_2012_4266_Fig2_HTML.jpg
                      Figure 2

                      A representative image of DNA fingerprints of the positive BAC clones for determination of overlapping relationship. The positive BAC clones identified in the previous steps were digested with Hind III, followed by separation on a 1% agarose gel in 1× TAE buffer. The gel was stained with Ethidium Bromide (EB) for photograph with a UVP Labworks system. M: Marker of DNA size standard (1 kb plus DNA ladder from Invitrogen, San Diego, CA, USA) with the base pair (bp) sizes indicated on both sides.

                      For cross-checking of the clone order, BAC-end sequencing was performed for all overlapping BAC clones, and the sequences generated were used to design BAC-end oligo primers (Additional file 1: Table S1) for further verification of overlapping relationships. The sequences of 185 BAC-ends have been deposited into the NCBI database with the access number HR309252 through HR309068, corresponding to dbGSS ID 30164010 through 30163826.

                      Cross verification and physical map assembling

                      For additional cross-verification of the BAC clone orders, a total of 108 pairs of BAC-end oligo primers were designed for amplification by PCR of the common loci in two overlapping BACs (Figure3). Verification PCR confirmed the results of DNA fingerprinting at a high level of accuracy. Out of the 108 primer pairs used, 103 produced the specific PCR products with the expected size, the overall success rate reached 95% (Additional file 1: Table S1). An overlapping relationship between two BACs was further verified if the common target loci were detected from both BACs in the overlapped region. A total of five pairs of oligo primers failed to generate the specific PCR band, or failed to produce the PCR fragment at the expected size.
                      http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-13-398/MediaObjects/12864_2012_4266_Fig3_HTML.jpg
                      Figure 3

                      PCR verification of the overlapping relationship between pairs of overlapping BAC clones. Pairs of overlapped BAC clones were PCR amplified using a primer pair designed based on the BAC-end sequence. The markers above the black lines define the primer pairs and the ones below the lines are numbers of positive clones used as PCR templates.

                      A complete physical map of a BAC clone contig for the ovine MHC region between class IIa and IIb was successfully assembled (Figure4), based on the integrated results of DNA fingerprinting, BAC-end sequencing, and confirmation PCR of the BAC ends. The fully assembled physical map was composed of 108 effective ovine BAC clones organized into a continuous contig that covered the entire region between ovine MHC class IIa and IIb (Figure4). Based on the results of DNA fingerprinting, no gaps exist in the constructed BAC clone physical map which spans approximately 14 Mb genome region of ovine chromosome 20, indicating the even distribution of BAC clones in the library we previously constructed.
                      http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-13-398/MediaObjects/12864_2012_4266_Fig4_HTML.jpg
                      Figure 4

                      A 14 Mb BAC clone physical map covering the entire region between ovine MHC Class IIa and IIb. The order and orientation of BAC clones (overlapping horizontal bars with clone ID name listed above) were determined by combinations of DNA fingerprinting, BAC-end sequencing, and sequence-specific-PCR. Target gene identified by BAC-end sequencing is marked with a vertical bar along the horizontal line, with locus name listed above. The continuous BAC map is represented by three panels with the overlapping regions marked with the same colored shadows at the both ends.

                      Discussion

                      Using the comparative approaches, we successfully constructed a 14 Mb BAC clone contig map for a region in ovine chromosome 20 that harbors the MHC. Comparison between the identified ovine BAC contig and the orthologous bovine genomic region showed that the two species share essentially the same genomic structure and organization for the entire inversion/insertion between MHC class IIa and IIb (Figure5). For the available genetic loci generated via the SP-PCR and BAC-end sequencing, our results essentially confirmed the sheep genome sequence assembly presented by ISGC in the MHC region [33].
                      http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-13-398/MediaObjects/12864_2012_4266_Fig5_HTML.jpg
                      Figure 5

                      Schematic presentation of MHC structures among representative mammal species. Bovine and ovine MHC is interrupted by a long piece of non-MHC insertion that divided class II into IIa and IIb subregions. The red, blue, and green color stands for MHC Class I, Class III, and Class II, respectively. The grey color gradient represents the extended Class II region. The order of loci in the extended Class II region of bovine and ovine is in an opposite orientation compared to that of human, chimpanzees, and mouse. Dash line marks the break point of a hypothetical chromosome inversion. Dashed circles indicate the hypothetical chromosome looping and the subsequent crossover occurred during the evolution of ruminants. The drawing is not to the scale.

                      The physical map of ovine BAC contig we constructed helped to provide additional evidence to support the hypothesis that, there was an ancient chromosome rearrangement in the ancestor of ruminants which shaped the MHC structures currently observed in the ovine and bovine (Figure5). It is obvious that the MHC region in human, mouse and chimpanzees is continuous with no interruption, but in bovine and ovine it is interrupted by a large piece of autosome insertion which divided MHC class II into IIa and IIb subregions (Figure5). Given the fact of opposite loci order and orientation for the insertion region in ovine and bovine relative to those of human and mouse, it is highly possible that an event of genetic recombination occurred to the ancestor chromosome of ruminants, probably via chromosome looping and the subsequent crossover. This possibility was suggested by researchers previously [29, 38].

                      Examination of the bovine DNA sequence from the public database showed that the total length of bovine MHC is ~20 Mb, including the extended Class IIb region [34]. However, the total length of the orthologous ovine MHC was ~14.3 Mb as determined in this study, which is approximately 5.7 Mb shorter than the MHC of bovine. On the other hand, the sequence of the same bovine region presented in the NCBI database is ~18 Mb in length (http://​www.​ncbi.​nlm.​nih.​gov/​projects/​mapview/​maps.​cgi?​taxid=​9913&​chr=​23). These discrepancies may not likely be resolved unless highly accurate sequence maps for the entire MHC regions become available.

                      The reliability of the ovine BAC contig map reported here is sufficiently high in theory, partially due to the fact that the DNA fingerprinting was utilized to infer the BAC clone orders, plus the results were cross-verified by both of the BAC-end sequencing and SP-PCR amplification of the target loci. However, it is not escaped from our attention that there are 5 out of the 108 overlapping locations in the BAC map where the SP-PCR failed to generate the expected PCR products between the overlapping BAC clones (data not shown). The significance of such failure in relation to the overall quality of the map remains to be determined. The possible explanations include the error in SP-PCR primer sequences, the high level of heterogeneity or polymorphism of the target locus involved, or the mistake in the interpretation of results of DNA fingerprinting.

                      Combined with our previous BAC physical map for the ovine MHC, we have now assembled a completed BAC clone physical map with the inversion/insertion region included (Additional file 2: Figure S1). The physical map will help to generate an ovine MHC sequencing map with a high level of accuracy, which in turn will facilitate MHC functional studies and comparative MHC evolution studies in ruminants. DNA sequencing of the BACs is currently underway.

                      Conclusion

                      We constructed a high-density physical map for the sheep genome region between MHC class IIa and IIb via comparative approaches. A total of 108 effective ovine BAC clones were selected to form a continuous BAC contig that covers the entire non-MHC insertion. The map spans approximately 14 Mb in length, constituting ~25% of ovine chromosome 20. The entire ovine MHC region, including the autosome insertion for which the physical map has been constructed, is now fully covered by a continuous BAC clone contig. The accuracy of DNA sequences play vital roles in detailed SNP and other functional studies of MHC genes, as well as for genome evolution studies. The physical map will help to generate ovine MHC sequencing map with a high level of accuracy, which in turn will facilitate MHC functional studies, as well as the comparative MHC evolution in ruminants.

                      Declarations

                      Acknowledgements

                      The authors are very appreciative of the expert reviewers who helped to improve the quality of the manuscript significantly. This work was funded by research grants from National Natural Science Foundation of China (30125024; 30771148), Ministry of Science and Technology of China (2006DFB33750; 2010CB530204), and China Ministry of Agriculture (2009ZX08008-005B).

                      Authors’ Affiliations

                      (1)
                      School of Life Sciences, Shihezi University
                      (2)
                      State Key Laboratory of Molecular Developmental Biology, Institute of Genetics and Developmental Biology, Chinese Academy of Science
                      (3)
                      Institute of Veterinary Animal and Biomedical Sciences, Massey University
                      (4)
                      Joint Research Center for Sheep Breeding and Developmental Biology, IGDB-Massey University
                      (5)
                      Graduate University of Chinese Academy of Sciences
                      (6)
                      Institute of Genetics and Developmental Biology, Chinese Academy of Science

                      References

                      1. Nei M, Rooney AP: Concerted and birth-and-death evolution of multigene families. Annu Rev Genet 2005, 39:121–152.PubMedView Article
                      2. Spurgin LG, Richardson DS: How pathogens drive genetic diversity: MHC, mechanisms and misunderstandings. Proc Biol Sci 2010,277(1684):979–988.PubMedView Article
                      3. Trowsdale J: The MHC, disease and selection. Immunol Lett 2011,137(1–2):1–8.PubMedView Article
                      4. Bonneaud C, Richard M, Faivre B, Westerdahl H, Sorci G: An Mhc class I allele associated to the expression of T-dependent immune response in the house sparrow. Immunogenetics 2005,57(10):782–789.PubMedView Article
                      5. Dukkipati VS, Blair HT, Garrick DJ, Murray A: Ovar-Mhc–ovine major histocompatibility complex: role in genetic resistance to diseases. N Z Vet J 2006,54(4):153–160.PubMedView Article
                      6. Galindo RC, Ayoubi P, Garcia-Perez AL, Naranjo V, Kocan KM, Gortazar C, de la Fuente J: Differential expression of inflammatory and immune response genes in sheep infected with Anaplasma phagocytophilum. Vet Immunol Immunopathol 2008,126(1–2):27–34.PubMedView Article
                      7. Konnai S, Takeshima SN, Tajima S, Yin SA, Okada K, Onuma M, Aida Y: The influence of ovine MHC class II DRB1 alleles on immune response in bovine leukemia virus infection. Microbiol Immunol 2003,47(3):223–232.PubMed
                      8. Mena A, Nichani AK, Popowych Y, Ioannou XP, Godson DL, Mutwiri GK, Hecker R, Babiuk LA, Griebel P: Bovine and ovine blood mononuclear leukocytes differ markedly in innate immune responses induced by Class A and Class B CpG-oligodeoxynucleotide. Oligonucleotides 2003,13(4):245–259.PubMedView Article
                      9. Buitkamp J, Filmether P, Stear MJ, Epplen JT: Class I and class II major histocompatibility complex alleles are associated with faecal egg counts following natural, predominantly Ostertagia circumcincta infection. Parasitol Res 1996,82(8):693–696.PubMedView Article
                      10. Dukkipati VS, Blair HT, Garrick DJ, Murray A: 'Ovar-Mhc' - ovine major histocompatibility complex: structure and gene polymorphisms. Genet Mol Res 2006,5(4):581–608.PubMed
                      11. Gruszczynska J, Brokowska K, Charon KM, Swiderek WP: Restriction fragment length polymorphism of exon 2 Ovar-DRB1 gene in Polish Heath Sheep and Polish Lowland Sheep. J Appl Genet 2005,46(3):311–314.PubMed
                      12. Liu H, Liu K, Wang J, Ma RZ: A BAC clone-based physical map of ovine major histocompatibility complex. Genomics 2006,88(1):88–95.PubMedView Article
                      13. Liu K, Zhang P, Gao J, Liu H, Li G, Qiu Z, Zhang Y, Ren J, Tan P, Ma RZ: Closing a gap in the physical map of the ovine major histocompatibility complex. Anim Genet 2011,42(2):204–207.View Article
                      14. Gao J, Liu K, Liu H, Blair HT, Li G, Chen C, Tan P, Ma RZ: A complete DNA sequence map of the ovine major histocompatibility complex. BMC Genomics 2010, 11:466.PubMedView Article
                      15. Miltiadou D, Ballingall KT, Ellis SA, Russell GC, McKeever DJ: Haplotype characterization of transcribed ovine major histocompatibility complex (MHC) class I genes. Immunogenetics 2005,57(7):499–509.PubMedView Article
                      16. Mahdy EA, Makinen A, Chowdhary BP, Andersson L, Gustavsson I: Chromosomal localization of the ovine major histocompatibility complex (OLA) by in situ hybridization. Hereditas 1989,111(1):87–90.PubMed
                      17. Escayg AP, Hickford JG, Bullock DW: Association between alleles of the ovine major histocompatibility complex and resistance to footrot. Res Vet Sci 1997,63(3):283–287.PubMedView Article
                      18. Ballingall KT, Fardoe K, McKeever DJ: Genomic organisation and allelic diversity within coding and non-coding regions of the Ovar-DRB1 locus. Immunogenetics 2008,60(2):95–103.PubMedView Article
                      19. Deverson EV, Wright H, Watson S, Ballingall K, Huskisson N, Diamond AG, Howard JC: Class II major histocompatibility complex genes of the sheep. Anim Genet 1991,22(3):211–225.PubMedView Article
                      20. Escayg AP, Hickford JG, Montgomery GW, Dodds KG, Bullock DW: Polymorphism at the ovine major histocompatibility complex class II loci. Anim Genet 1996,27(5):305–312.PubMedView Article
                      21. Scott PC, Choi CL, Brandon MR: Genetic organization of the ovine MHC class II region. Immunogenetics 1987,25(2):116–122.PubMedView Article
                      22. Snibson KJ, Maddox JF, Fabb SA, Brandon MR: Allelic variation of ovine MHC class II DQA1 and DQA2 genes. Anim Genet 1998,29(5):356–362.PubMedView Article
                      23. van der Poel JJ, Groenen MA, Dijkhof RJ, Ruyter D, Giphart MJ: The nucleotide sequence of the bovine MHC class II alpha genes: DRA, DOA, and DYA. Immunogenetics 1990,31(1):29–36.PubMedView Article
                      24. Childers CP, Newkirk HL, Honeycutt DA, Ramlachan N, Muzney DM, Sodergren E, Gibbs RA, Weinstock GM, Womack JE, Skow LC: Comparative analysis of the bovine MHC class IIb sequence identifies inversion breakpoints and three unexpected genes. Anim Genet 2006,37(2):121–129.PubMedView Article
                      25. Devilee P, Warnaar JN, Giphart MJ: MHC homology between various mammalian species at the DNA level: its relevance to MHC evolution. Exp Clin Immunogenet 1984,1(2):90–98.PubMed
                      26. Qin J, Mamotte C, Cockett NE, Wetherall JD, Groth DM: A map of the class III region of the sheep major histocompatibilty complex. BMC Genomics 2008, 9:409.PubMedView Article
                      27. Wright H, Ballingall KT, Redmond J: The DY sub-region of the sheep MHC contains an A/B gene pair. Immunogenetics 1994,40(3):230–234.PubMedView Article
                      28. Hickford JG, Ridgway HJ, Escayg AP: Evolution of the ovine MHC DQA region. Anim Genet 2000,31(3):200–205.PubMedView Article
                      29. Amills M, Ramiya V, Norimine J, Lewin HA: The major histocompatibility complex of ruminants. Rev Sci Tech 1998,17(1):108–120.PubMed
                      30. Everts-van Der Wind A, Kata SR, Band MR, Rebeiz M, Larkin DM, Everts RE, Green CA, Liu L, Natarajan S, Goldammer T, et al.: A 1463 gene cattle-human comparative map with anchor points defined by human genome sequence coordinates. Genome Res 2004,14(7)):1424–1437.PubMedView Article
                      31. Maddox JF, Davies KP, Crawford AM, Hulme DJ, Vaiman D, Cribiu EP, Freking BA, Beh KJ, Cockett NE, Kang N, et al.: An enhanced linkage map of the sheep genome comprising more than 1000 loci. Genome Res 2001,11(7):1275–1289.PubMedView Article
                      32. McShane RD, Gallagher DS Jr, Newkirk H, Taylor JF, Burzlaff JD, Davis SK, Skow LC: Physical localization and order of genes in the class I region of the bovine MHC. Anim Genet 2001,32(5):235–239.PubMedView Article
                      33. Archibald AL, Cockett NE, Dalrymple BP, Faraut T, Kijas JW, Maddox JF, McEwan JC, Hutton Oddy V, Raadsma HW, Wade C, et al.: The sheep genome reference sequence: a work in progress. Anim Genet 2010,41(5):449–453.PubMedView Article
                      34. Elsik CG, Tellam RL, Worley KC, Gibbs RA, Muzny DM, Weinstock GM, Adelson DL, Eichler EE, Elnitski L, Guigo R, et al.: The genome sequence of taurine cattle: a window to ruminant biology and evolution. Science 2009,324(5926):522–528.PubMedView Article
                      35. Osoegawa K, Woon PY, Zhao B, Frengen E, Tateno M, Catanese JJ, de Jong PJ: An improved approach for construction of bacterial artificial chromosome libraries. Genomics 1998,52(1):1–8.PubMedView Article
                      36. Marra MA, Kucaba TA, Dietrich NL, Green ED, Brownstein B, Wilson RK, McDonald KM, Hillier LW, McPherson JD, Waterston RH: High throughput fingerprint analysis of large-insert clones. Genome Res 1997,7(11):1072–1084.PubMed
                      37. Soderlund C, Longden I, Mott R: FPC: a system for building contigs from restriction fingerprinted clones. Comput Appl Biosci 1997,13(5):523–535.PubMed
                      38. Lewin HA, Russell GC, Glass EJ: Comparative organization and function of the major histocompatibility complex of domesticated cattle. Immunol Rev 1999, 167:145–158.PubMedView Article

                      Copyright

                      © Li et al.; licensee BioMed Central Ltd. 2012

                      This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://​creativecommons.​org/​licenses/​by/​2.​0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

                      Advertisement