Open Access

A complete mitochondrial genome sequence of the wild two-humped camel (Camelus bactrianus ferus): an evolutionary history of camelidae

Contributed equally
BMC Genomics20078:241

DOI: 10.1186/1471-2164-8-241

Received: 17 March 2007

Accepted: 18 July 2007

Published: 18 July 2007

Abstract

Background

The family Camelidae that evolved in North America during the Eocene survived with two distinct tribes, Camelini and Lamini. To investigate the evolutionary relationship between them and to further understand the evolutionary history of this family, we determined the complete mitochondrial genome sequence of the wild two-humped camel (Camelus bactrianus ferus), the only wild survivor of the Old World camel.

Results

The mitochondrial genome sequence (16,680 bp) from C. bactrianus ferus contains 13 protein-coding, two rRNA, and 22 tRNA genes as well as a typical control region; this basic structure is shared by all metazoan mitochondrial genomes. Its protein-coding region exhibits codon usage common to all mammals and possesses the three cryptic stop codons shared by all vertebrates. C. bactrianus ferus together with the rest of mammalian species do not share a triplet nucleotide insertion (GCC) that encodes a proline residue found only in the nd1 gene of the New World camelid Lama pacos. This lineage-specific insertion in the L. pacos mtDNA occurred after the split between the Old and New World camelids suggests that it may have functional implication since a proline insertion in a protein backbone usually alters protein conformation significantly, and nd1 gene has not been seen as polymorphic as the rest of ND family genes among camelids. Our phylogenetic study based on complete mitochondrial genomes excluding the control region suggested that the divergence of the two tribes may occur in the early Miocene; it is much earlier than what was deduced from the fossil record (11 million years). An evolutionary history reconstructed for the family Camelidae based on cytb sequences suggested that the split of bactrian camel and dromedary may have occurred in North America before the tribe Camelini migrated from North America to Asia.

Conclusion

Molecular clock analysis of complete mitochondrial genomes from C. bactrianus ferus and L. pacos suggested that the two tribes diverged from their common ancestor about 25 million years ago, much earlier than what was predicted based on fossil records.

Background

The family Camelidae has two Old World (tribe Camelina) species, bactrian camel (Camelus bactrianus) and dromedary (C. dromedaries), and four New World (tribe Lamini) species, guanaco (Lama guanico e), llama (L. glama), alpaca (L. pacos) and vicuna (L. vicugna or Vicugna vicugna) at present time [1, 2]. The wild bactrian camel (C. bactrianus ferus) appears to be the only wild survivor of the Old World camel. According to the fossil record, Camelidae evolved in North America during the Eocene, approximately 40–45 million years ago [2], and the division between Camelini and Lamini occurred in North America about 11 million years ago [3, 4]. In the late Tertiary (the epoch Pliocene) the species of Camelini and Lamini migrated from North America to South America and Asia separately, and their ancestors became extinct in North America subsequently. However, there have been very few molecular studies due to difficulties in either obtaining enough DNA samples or acquiring enough sequence information. Previous molecular studies, mainly focusing on the sequence of mitochondrial cytochrome b gene, have made significant contributions to understanding the evolutionary history of Camelidae [2], and yet there has not been any significant comparative studies on the evolutionary relationship between Camelini and Lamini.

Mitochondrial DNA (mtDNA) has been proven useful for studying evolutionary relationships among animal species, due to its conservativeness in protein-coding sequences, high substitution rate in its non-coding sequences, and lack of genetic recombination [5, 6]. To investigate the evolutionary relationship between Camelini and Lamini, we have made an unprecedented effort to obtain adequate samples from the wild two-humped camel, sequenced its mitochondrial genome completely, and carried out detailed sequence and evolutionary analyses.

Results

Genome organization

Since mammalian mitochondrial genome sequences are very similar, we designed a set of PCR primers based on highly conserved sequences of an alignment with full-length mitochondrial genomes from the available public data, including those of cow, deer, sheep, pig, and lama (Table 1). We sequenced some of the PCR-amplified DNA segments first to obtain as much authentic sequences as possible from the wild two-humped camel, and subsequently designed new primers according to the newly acquired sequences. We collected 119 raw sequence traces with an average length of 521 bp at a quality value of Q20, which cover the entire genome four folds.
Table 1

PCR primers used for the experiment

Primer

Sequence(5' -3')

Strand

12s-121a

GGAGCTGGTATCAAGCAC

upper

12s-942

CAGTATGCTTACCTTGTTAC

lower

16s-136

GCTATAGAGAAAGTACCGTAAG

upper

16s-648

CTCATATTAACATTATTGCTTC

lower

16s-1053

ACTGTCTCTTACTTCCAATC

upper

16s-1478

ATAGATAGAAACCGACCTG

lower

nd1-85

AGTAGAACGAAAAGTCCTAG

upper

nd2-791

TTAATTCTTGGATGATTATTC

lower

cox2-380

ACTCCTATATAATCCCAACATCAG

upper

atp6-449

GCTAGGGCTACTGGTTGAATAA

lower

atp6-301

ACACCAACTACACAACTATCAATAA

upper

cox3-188

CTTGGAAGGTGCTTTCTC

lower

cox3-205

GAGAAAGCACCTTCCAAG

upper

cox3-717

TCTACGAAATGTCAATATCAG

lower

nd4-379

TCCTATTTGAAGCAACACTAG

upper

nd4-804

ATTGAGCTGGTTATAATTATG

lower

nd5-767

CTCAAGCACAATAGTAGTAGCAGG

upper

cytb-830

ATTGATCGTAAGATTGCGTATG

lower

cytb-419

CCATGAGGACAAATATCATT

upper

cytb-1001

CCTCCAATTCATGTGAGTG

lower

aThe numbers refer to the position of PCR primers (3') in mitochondrial genes.

The full-length mitochondrial genome is 16,680 bp in length [GenBank: EF212038], which is 28 bp longer than that of L. pacos. The minor length variation mainly occurred in the tandem repeat (ACGTAC)n of the control region. The gene order and content are identical to those of other mammals (Figure 1); it harbors 13 protein-coding genes (three subunits of the cytochrome c oxidase, seven subunits of the NADH ubiquinone oxidoreductase complex, one subunit of the ubiquinol cytochrome b oxidoreductase complex, and two subunits of ATP synthases), the small and large ribosomal RNA genes, and 22 tRNA genes (Table 2). The replication origin of the light strand within a tRNA gene cluster was also unambiguously identified.
https://static-content.springer.com/image/art%3A10.1186%2F1471-2164-8-241/MediaObjects/12864_2007_Article_954_Fig1_HTML.jpg
Figure 1

The mitochondrial genome of C. bactrianus ferus (16,680 bp). Protein-coding genes (black) and rRNA genes (light-gray) are identified by arrows. The gene nd6 is transcribed in the opposite direction as relative to the rest in the cluster. tRNA genes are depicted with their corresponding amino acids.

Table 2

Organization of Camelus bactrianus ferus mitochondrial genome

Gene/element

Strand

Position

Start

Stop

Size

GC %

tRNA-Phe

H

1–67

-

-

67

41.79

12S rRNA

H

68–1034

-

-

967

43.54

tRNA-Val

H

1035–1100

-

-

66

38.57

16S rRNA

H

1101–2666

-

-

1566

38.25

tRNA-Leu

H

2667–2741

-

-

75

42.67

nd1

H

2745–3701

ATG

TAA

957

45.24

tRNA-Ile

H

3701–3769

-

-

69

30.43

tRNA-Gln

L

3767–3839

-

-

73

35.71

tRNA-Met

H

3841–3909

-

-

69

45.25

nd2

H

3910–4953

ATA

TAG

1044

37.07

tRNA-Trp

H

4966–5019

-

-

54

43.24

tRNA-Ala

L

5025–5093

-

-

69

43.48

tRNA-Asn

L

5095–5167

-

-

73

39.21

OL

-

5157–5211

-

-

55

52.75

tRNA-Cys

L

5201–5267

-

-

67

40.58

tRNA-Tyr

L

5268–5336

-

-

69

41.30

cox1

H

5338–6885

ATG

TAG

1548

44.12

tRNA-Ser

L

6887–6957

-

-

71

39.44

tRNA-Asp

H

6962–7028

-

-

67

40.68

cox2

H

7029–7712

ATG

TAA

684

40.94

tRNA-Lys

H

7716–7782

-

-

67

47.76

atp8

H

7784–7987

ATG

TAA

204

34.80

atp6

H

7945–8625

ATG

TAA

681

39.20

cox3

H

8625–9403

ATG

T . .

779

47.75

tRNA-Gly

H

9409–9478

-

-

70

30.43

nd3

H

9476–9825

ATA

TA .

350

43.14

tRNA-Arg

H

9826–9893

-

-

68

44.93

nd4l

H

9894–10190

ATG

TAA

297

40.74

nd4

H

10184–11570

ATG

T . .

1387

42.39

tRNA-His

H

11562–11630

-

-

69

34.78

tRNA-Ser

H

11631–11689

-

-

59

44.12

tRNA-Leu

H

11691–11760

-

-

70

39.73

nd5

H

11761–13581

ATA

TAA

1821

41.30

nd6

L

13565–14092

ATG

TAA

528

41.48

tRNA-Glu

L

14094–14162

-

-

69

34.78

cytb

H

14167–15306

ATG

AGA

1140

43.25

tRNA-Thr

H

15307–15375

-

-

69

34.80

tRNA-Pro

H

15375–15440

-

-

66

43.84

Control region

H

15441–16687

-

-

1247

46.75

H and L refer to heavy and light strains of the mitochondrial genome, respectively.

Protein-coding genes

We carefully annotated 13 protein-coding genes (Table 2), including start and stop codons (ten ATGs, three ATAs, seven TAAs, two TAGs, and one AGA). Three of them, cox3,nd3, and nd4, do not have normal stop codons but have the cryptic components, T, TA, and T, respectively. The possession of such noncanonical start and stop codons is shared by most of the vertebrate mitochondrial genomes. These T or TA stop codon components are supplemented via posttranscriptional polyadenylation later in the cellular translation process [7]. Another common feature among vertebrate mitochondrial genomes is the existence of overlapping genes; for instance, ATP6 and ATP8 share a 42-bp sequence.

The mitochondrial genome of the wild camel shares its genetic code with other vertebrates (Table 3). In this mtDNA, the codon CTA for leucine is the most frequently used (277 times) and the codon CGT for arginine is the least frequently found (7 times) even though both amino acids are separately encoded by six and four codons in the canonical genetic code. The codons ending with A or T are used more frequently than those ending with G or C since it has a high A+T (57.9%) content similar to what have been found among other mammals.
Table 3

Comparison of codon usage among Camelus bactrianus ferus and selected vertebrates

AAa

Codon

Camel

Alpaca

Dog

AA

Codon

Camel

Alpaca

Dog

G

GGC

67

63

51

M

ATA

177

195

201

 

GGA

92

91

93

 

ATG

75

58

47

 

GGG

36

30

28

D

GAT

28

31

28

A

GCT

57

52

63

 

GAC

41

42

41

 

GCC

109

103

86

E

GAA

61

66

73

 

GCA

88

88

89

 

GAG

35

28

21

 

GCG

12

9

14

N

AAT

59

73

66

V

GTT

46

43

49

 

AAC

92

71

91

 

GTC

49

60

27

Q

CAA

67

78

68

 

GTA

80

84

65

 

CAG

23

15

21

 

GTG

33

15

24

K

AAA

77

83

81

L

TTA

97

97

117

 

AAG

19

18

19

 

TTG

32

15

28

R

CGT

7c

6

6

 

CTT

72

68

96

 

CGC

14

16

10

 

CTC

97

93

90

 

CGA

39

39

45

 

CTA

227b

279

230

 

CGG

8

4

4

 

CTG

68

46

33

H

CAT

28

28

38

I

ATT

179

167

174

 

CAC

63

65

57

 

ATC

134

151

168

P

CCT

54

43

64

S

TCT

55

54

68

 

CCC

81

84

62

 

TCC

75

69

74

 

CCA

49

61

60

 

TCA

71

80

78

 

CCG

12

10

7

 

TCG

10

8

12

F

TTT

103

122

108

T

ACT

60

70

75

 

TTC

133

108

127

 

ACC

97

89

90

Y

TAT

69

68

69

 

ACA

126

142

120

 

TAC

68

73

74

 

ACG

34

19

18

W

TGA

88

90

94

C

TGT

11

9

4

 

TGG

17

15

10

a The one-letter code for amino acids (AA) was used;

b the most frequently used codon;

c the least frequently used codon.

Transfer RNA genes

We identified 22 tRNA genes in mtDNA of the wild camel; 21 of them were predicted capable of folding into the cloverleaf structure and possess anticodons that match the vertebrate mitochondrial genetic code (Figure 2A). Only one of them, tRNAser lacks the appropriate sequence elements for forming an orthodox cloverleaf structure as well as both dihydrouridine loop and the anticodon (Figure 2B). Although it has been predicted that this tRNAser gene (for AGN) may be a pseudogene as observed among other metazoan mitochondrial genomes and some of them were proven inactive [8], efforts have been made to uncover underlying molecular details as to how serine residues are actually added into peptide chains with this "bizarre" tRNA [9].
https://static-content.springer.com/image/art%3A10.1186%2F1471-2164-8-241/MediaObjects/12864_2007_Article_954_Fig2_HTML.jpg
Figure 2

Predicted secondary structures of 22 mitochondrial tRNA sequences from the wild camel. All tRNAs were folded into secondary structures based on the "least free energy" principle. (A) 21 tRNAs exhibit cloverleaf structures and possess anticodons. The secondary structure of tRNAAsn was shown (bold) as an example for the cloverleaf structure that usually has 7 bp in the aminoacyl stems, 4 bp or 5 bp in the TψC and anticodon stems, and 4 bp or 3 bp in the DHU stems. tRNA stem regions include some non-complementary and T:G base pairings. (B) tRNAser can not form the appropriate dihydrouridine loop and does not possess the anticodon for AGN.

Non-coding sequences

Among vertebrate mitochondrial genomes, most of the non-coding sequences are part of the control region, about 700–1,300 bp in length, responsible for the regulation of replication and transcription [10]. The control region shows extensive variability across taxonomic groups and even among related species, but its sequence elements related to regulatory functions are known to be highly conserved. We annotated the 1,247-bp control region and regulatory domains; at the 5' end, we found termination-associated sequence (TAS) motifs that act as a signal for terminating synthesis of the D-loop strand [11, 12]. The sequence between bactrian camel and alpaca showed less similarity as expected (Figure 3). We also discovered all eight putative conserved sequence blocks (CSB1-3 and B-F) that are important to the regulation of mtDNA replication [12]; among them, CSB1 and CSBC-F are conserved among mammals, whereas CSB2 and CSB3 are absent from some of them.
https://static-content.springer.com/image/art%3A10.1186%2F1471-2164-8-241/MediaObjects/12864_2007_Article_954_Fig3_HTML.jpg
Figure 3

Alignment of termination-associated sequences (TAS) and eight putative conserved sequence blocks of CBS (1–3) and CBS (B-F). The bactrian camel sequence was used as the consensus sequence, orientated from 5' to 3' on the heavy strand. Dots, dashes, and numbers indicate nucleotide identity, indels, and positions of the first and the last nucleotide for each identified region, respectively.

Mitochondrial DNA variations in camelidae

To investigate mitochondrial DNA variations in Camelidae, we compared the two complete sequences from the wild camel and alpaca; the comparison yielded 1,522 transitions and 389 transversions when excluding the highly variable control region. We also identified 26 single nucleotide indels (insertions or deletions) from non-coding RNA sequences. The most striking observation was a codon indel (GCC) encodes proline residue found in the nd1 gene between C. bactrianus ferus and L. pacos. This indel, upon further scrutiny, is actually an insertion in the L. pacos mtDNA but absolutely absent in the rest of mammalian mtDNA collection. In other words, it is lineage-specific to the New World L. pacos, suggesting that an insertion event occurred after the Old and New World Camelidae split. Furthermore, our comparative analyses showed a relatively lower ratio of nonsynonymous substitution (Ka) to synonymous substitution (Ks) in cox1, cox2, cox3, and cytb genes (Table 4), whereas a large number of nonsynonymous substitutions were observed in nd2, nd3, nd4, nd4L, and atp6 gene sequences, especially in the atp8 gene. This result indicates that the ND family and ATP synthase genes may evolve faster than other genes among the 13 protein-coding ones. This pattern is not universal among all mammalian mitochondrial genomes and suggests its functional relevance for mitochondrial biology. To our surprise, the nd1 gene that harbors the codon insertion in L. pacos does not appear to have higher mutation rate as compared to other ND family genes in its mtDNA.
Table 4

The ratio of nonsynonymous substitution (Ka) vs. synonymous substitution (Ks) among the mitochondrial genes

Gene

Ka

Ks

Ka/Ks

nd6

0.056

1.248

0.045

atp6

0.040

0.598

0.067

atp8

0.162

0.557

0.290

cox1

0.009

0.866

0.010

cox2

0.024

1.123

0.021

cox3

0.026

1.601

0.016

cytb

0.051

1.271

0.040

nd1

0.023

1.847

0.012

nd2

0.043

0.665

0.064

nd3

0.063

0.929

0.068

nd4

0.028

1.008

0.028

nd4l

0.040

0.874

0.046

nd5

0.056

1.123

0.050

Phylogenetic analyses

To date the divergence time between Camelini and Lamini, we aligned complete mtDNA sequences of the wild camel and alpaca as well as other selected mammals. We then constructed a phylogenetic tree from these aligned sequences by using those of rat and mouse as outgroup (Figure 4). Since the control region of mtDNA has a high incidence of homoplasy [5, 13], we excluded it for this analysis. Similar topology was obtained with both neighbor-joining and maximum likelihood methods. Bootstrap values and Bayesian posterior probabilities were showed for all clades.
https://static-content.springer.com/image/art%3A10.1186%2F1471-2164-8-241/MediaObjects/12864_2007_Article_954_Fig4_HTML.jpg
Figure 4

The phylogenic relationship between bactrian camel and alpaca based on maximum likelihood analysis (without the control regions). To estimate the divergence time, cow and pig were taken as an ingroup calibration point, while the mouse and rat were taken as an outgroup calibration point. All nodes were supported by the bootstrap value (1000 replications) and posterior probability on the nodes (above the branch is the bootstrap value, and below the branch is posterior probability). The scale bar indicates 0.1 substitutions.

Estimating divergence time can be done with or without assuming a constant rate evolutionary rate among all compared clades. Since evolutionary rate of Camelidae mitochondrial genomes has not been well-studied, we tested the rate constancy in Camelidae using mtDNA excluding the control region. We first performed Tajima's relative rate test, using cow as an outgroup. Molecular clock analyses are highly sensitive to evolutionary distance between main clades and the choice of an outgroup is of importance [14]. The result rejected the assumption of a constant rate of change among the camelid mitochondrial genomes (p < 0.01, unpublished data). To further confirm this conclusion, we used likelihood ratio method for a similar test (Materials and Methods), and showed obvious differences in the evolutionary rate between the two tribes (without rate constancy LnL1 = -38557.259972; with rate constancy LnL2 = -38550.07554; P < 0.01).

Since these studies pointed out that the assumption of rate constancy might not be appropriate for estimating divergence time between Camelini and Lamini, we used a heuristic rate smoothing procedure for ML-based estimates [15], which takes into account evolutionary rates among different branches of the tree. We used two calibration points, 65 and 14 million years, which were the estimated timing for the divergence of cow-pig (artiodactyl calibration) and mouse-rat (outgroup calibration), respectively [16, 17]. Average rates for the wild camel and alpaca were 1.2% per million years and 0.9% per million years, respectively. Therefore, the divergence time between Camelini and Lamini was estimated to be 25 million years, significantly earlier than what was estimated based on fossil records (11 million years). This result suggested that the divergence of the two tribes might occur in the early Miocene [2, 4].

We also constructed a phylogenetic tree based on the cytb gene sequences from the wild camel and other camelids, and looked into other possibilities (Figure 5). Similarly, we used the two calibration points, 65 and 14 million years, and performed a maximum likelihood procedure to estimate divergence time. In tribe Camelini, the divergence time of bactrian camel and dromedary was estimated as 8 million years, whereas in tribe Lamini, alpaca diverged from the other three species about 10 million years ago. Guanaco and llama diverged from their common ancestor in the early Pleistocene, 1.4 million years ago.
https://static-content.springer.com/image/art%3A10.1186%2F1471-2164-8-241/MediaObjects/12864_2007_Article_954_Fig5_HTML.jpg
Figure 5

Phylogeny of the Camelidae species based on maximum likelihood analysis of cytb sequences. To estimate the divergence time, pairwise comparisons of cow-pig and mouse-rat were taken as the ingroup and outgroup calibration points, respectively. All nodes were supported by the bootstrap value (1000 replications) on the nodes.

Discussion

Although the mitochondrial genome of the wild two-humped camel is highly similar to those of other mammals, there are substantial differences in the mtDNA evolutionary rate for different taxonomic groups. Relative rate tests demonstrated the evolutionary rate also varies between bactrian camel and other mammals (Table 5). The difference within a taxonomic group is as significant as among groups. For example, the rate for bactrian camel is significantly different from that for alpaca, so does the rate between bactrian camel and cow.
Table 5

Relative rate test for pairs among vertebrate lineages

Taxon pairs

Outgroup

x2

p

camel

cow

16.87

< 0.001

alpaca

   

camel

pig

40.38

< 0.001

cow

   

camel

cow

46.03

< 0.001

pig

   

camel

pig

25.11

< 0.001

deer

   

camel

pig

30.19

< 0.001

whale

   

The divergence time for Camelini and Lamini was estimated to be 25 million years or in the early Miocene. This estimate is significantly earlier than what were suggested based on the fossil record in North America [2, 4]. In tribe Camelini, we estimated that speciation of bactrian camel and dromedary may have begun 8 million years ago. If the time of the camel migrating from North America to Asia estimated based on the fossil material is correct (3 million years) [2, 4], the speciation of the genus Camelus may have occurred in North America. In tribe Lamini, alpaca is an older lineage that evolved to become the current species about 10 million years ago. In contrast, guanaco and llama diverged from their common ancestor much later, about 1.4 million years ago in the early Pleistocene; this divergence occurred after Lamini species migrated from North America to South America [2, 4].

Conclusion

The mtDNA of C. bactrianus ferus is very similar to that of other mammals. It contains 13 protein-coding, two rRNA, and 22 tRNA genes as well as a typical control region. Molecular clock analyses on complete mitochondrial genomes from C. bactrianus ferus and Lama pacos suggested that the two tribes diverged from their common ancestor about 25 million years ago, much earlier than what were suggested based on fossil record. The evolutionary history of Camelidae, reconstructed by using cytb sequences, suggested that the speciation of bactrian camel and dromedary may have occurred in North America before they migrated to South America and subsequently left the continent.

Methods

Specimens, DNA amplification, and sequencing

The samples (ear punches) from the wild two-humped camel were collected in the Gobi area (the Trans-Altai Gobi of Mongolia as described by Sanduin 2002) of Mongolia in 2006. Genomic DNA was extracted according to the proteinase K/phenol extraction method. A PCR-Based approach for mitochondrial genome sequencing was used ([18]. The PCR primers used for initial amplification were designed based on conserved known mammalian sequences from the public databases, and new primers were also designed according to the newly generated sequence data for finishing the entire genome.

The standard PCR was conducted in a 25 μl reaction volume that contains 1–2 U Taq DNA polymerase, 10 mM Tris-HCl (pH 8.3), 0.25 mM dNTPs, 0.2–2 mM BSA, 1.5–2.5 mM MgCl2, 20 pM of each primer, and about 10 ng camel genome DNA. The PCR reaction conditions were set as: 94°C for the first 5 min, followed by 35 cycles of 94°C denaturation for 30s, 50°C annealing for 30s, and 72°C extension for 45s. The PCR were accompanied by negative controls containing the reaction solutions without DNA.

The thermo-cycling sequencing reaction was performed in a final volume of 24 μl containing 16 μl DYEnamic ET Terminator Sequencing Kit premix, 10 pM sequencing primers, and 500 μg DNA. The reaction conditions were 95°C for 2 min, followed by 35 cycles of 95°C denaturation for 15s, 50°C annealing for 15s, and 60°C extension for 90s. The amplified DNA fragments were sequenced on ABI-3730 DNA sequencer. The primers for PCR reaction were used for sequencing. DNA sequences were assembled by using the software package phred/phrap/consed/[19, 20] on a PC/UNIX platform. The mitochondrial sequences were annotated with BLAST tools, and tRNA genes and their secondary structures were identified according to tRNAscan-SE [21].

Phylogenetic analysis

The complete mitochondrial genome of L. pacos [GenBank:Y19184],Bos taurus [GenBank:AY526085], Sus scrofa [GenBank:AF034253], Mus musculus [GenBank:AY172335], Rattus norvegicus [GenBank:AY172581] and cytb gene sequences [GenBank:EF212038, GenBank:EF212037, GenBank:AY535258, GenBank:U06430, GenBank:U06429, GenBank:Y19184, GenBank:AY526085, GenBank:AF034253, GenBank:AY172335, GenBank:AY172581] used for phylogenetic analysis and other mammals used for comparison and PCR primer designs were obtained from the NCBI database. Multiple alignments were performed with the CLUSTAL W [22]. Alignments of all protein-coding genes were used to estimate variation rates at synonymous (dS) and nonsynonymous (dN) sites with a maximum likelihood (ML) method [15] implemented in Ka_Ks_Calculator [23].

The phylogenic trees were reconstructed separately according to the neighbor-joining method implemented in MEGA [24] and the maximum likelihood method implemented in PHYLIP [25]. The reliability of the branches was assessed by bootstrap analysis (1000 replications). Bayesian posterior probability of phylogeny was done with MrBayes (mcmc ngen = 1000000) [26]. Two different prior models were used: the General Time Reversible model and the HKY model.

Rate constancy was tested with the Tajima's [27] and likelihood ratio tests. The likelihood ratio test was done with the baseml program in PAML. Two parameters of no molecular (clock = 0 in baseml) and the local clock (clock = 2 in baseml) were used to test molecular clock. When bactrian camel and alpaca were tested, cow was used as outgroup. To estimate the divergence time, a heuristic rate smoothing procedure for ML estimates was used as implemented in PAML [15]

Notes

Abbreviations

cox1, cox2, cox3

cytochrome oxidase subunit I, II, and III protein genes

atp6, atp8

ATP synthase subunit 6 and 8 geness

nad1, nad2, nad3, nad4, nad5, nad6, nad4L

NADH dehydrogenase subunit 1–6, 4L genes

cytb

cytochrome b gene

mtDNA: 

mitochondrial DNA

AA: 

amino acids.

Declarations

Acknowledgements

We would like to thank the Department of Environment Sources in Mongolia for the permission for sample collections. The work was supported by the Synergic Project of Ministry of Environment and Resource of the Republic of Mongolia and Inner Mongolia Agricultural University of China for Conservation of Wild Bactrian Camels.

Authors’ Affiliations

(1)
Key Laboratory of Dairy Biotechnology and Engineering Ministry of Education, College of Food Science and Engineering, Inner Mongolia Agricultural University
(2)
Key Laboratory of Genome Information and Sciences, Beijing Institute of Genomics, Chinese Academy of Sciences
(3)
Graduated School of the Chinese Academy of Sciences
(4)
School of Agriculture and biology, Shanghai Jiao Tong University

References

  1. Novoa CM: Genetic Improvement of South American Camelids. Revta bras Genet. 1989, 12: 123-135.Google Scholar
  2. Stanley HF, Kadwell M, Wheeler JC: Molecular evolution of the family Camelidae: a mitochondrial DNA study. Proceedings. 1994, 256 (1345): 1-6.Google Scholar
  3. Harrison JA: Revision of the Camelidae(Artiodactyla, Tylogoda) and description of the new genus Alforjas. PalaeontContr. 1979, 95: 1-20.Google Scholar
  4. Webb SD: Pleistocene Llamas of Florida, with a brief review of the Lamini. Pleistocene mammals of Florida. Edited by: Gainesville . 1974, Florida, University press of Florida, 170-214.Google Scholar
  5. Ingman M, Kaessmann H, Paabo S, Gyllensten U: Mitochondrial genome variation and the origin of modern humans. Nature. 2000, 408 (6813): 708-713. 10.1038/35047064.PubMedView ArticleGoogle Scholar
  6. Olivo PD, Van de Walle MJ, Laipis PJ, Hauswirth WW: Nucleotide sequence evidence for rapid genotypic shifts in the bovine mitochondrial DNA D-loop. Nature. 1983, 306 (5941): 400-402. 10.1038/306400a0.PubMedView ArticleGoogle Scholar
  7. Ojala D, Montoya J, Attardi G: tRNA punctuation model of RNA processing in human mitochondria. Nature. 1981, 290 (5806): 470-474. 10.1038/290470a0.PubMedView ArticleGoogle Scholar
  8. Wolstenholme DR: Animal mitochondrial DNA: structure and evolution. Int Rev Cytol. 1992, 141: 173-216.PubMedView ArticleGoogle Scholar
  9. Chimnaronk S, Gravers Jeppesen M, Suzuki T, Nyborg J, Watanabe K: Dual-mode recognition of noncanonical tRNAs(Ser) by seryl-tRNA synthetase in mammalian mitochondria. Embo J. 2005, 24 (19): 3369-3379. 10.1038/sj.emboj.7600811.PubMed CentralPubMedView ArticleGoogle Scholar
  10. Shadel GS, Clayton DA: Mitochondrial DNA maintenance in vertebrates. Annu Rev Biochem. 1997, 66: 409-435. 10.1146/annurev.biochem.66.1.409.PubMedView ArticleGoogle Scholar
  11. Clayton DA: Replication of animal mitochondrial DNA. Cell. 1982, 28 (4): 693-705. 10.1016/0092-8674(82)90049-6.PubMedView ArticleGoogle Scholar
  12. Clayton DA: Nuclear gadgets in mitochondrial DNA replication and transcription. Trends Biochem Sci. 1991, 16 (3): 107-111. 10.1016/0968-0004(91)90043-U.PubMedView ArticleGoogle Scholar
  13. Bjornerfeldt S, Webster MT, Vila C: Relaxation of selective constraint on dog mitochondrial DNA following domestication. Genome Res. 2006, 16 (8): 990-994. 10.1101/gr.5117706.PubMed CentralPubMedView ArticleGoogle Scholar
  14. Rogaev EI, Moliaka YK, Malyarchuk BA, Kondrashov FA, Derenko MV, Chumakov I, Grigorenko AP: Complete mitochondrial genome and phylogeny of Pleistocene mammoth Mammuthus primigenius. PLoS Biol. 2006, 4 (3): e73-10.1371/journal.pbio.0040073.PubMed CentralPubMedView ArticleGoogle Scholar
  15. Yang Z: A heuristic rate smoothing procedure for maximum likelihood estimation of species divergence times. Acta Zoologica Sinica. 2004, 50: 645-656.Google Scholar
  16. Springer MS, Murphy WJ, Eizirik E, O'Brien SJ: Placental mammal diversification and the Cretaceous-Tertiary boundary. Proc Natl Acad Sci U S A. 2003, 100 (3): 1056-1061. 10.1073/pnas.0334222100.PubMed CentralPubMedView ArticleGoogle Scholar
  17. Ursing BM, Arnason U: The complete mitochondrial DNA sequence of the pig (Sus scrofa). J Mol Evol. 1998, 47 (3): 302-306. 10.1007/PL00006388.PubMedView ArticleGoogle Scholar
  18. Yamauchi MM, Miya MU, Machida RJ, Nishida M: PCR-based approach for sequencing mitochondrial genomes of decapod crustaceans, with a practical example from kuruma prawn (Marsupenaeus japonicus). Mar Biotechnol (NY). 2004, 6 (5): 419-429. 10.1007/s10126-003-0036-2.View ArticleGoogle Scholar
  19. Ewing B, Green P: Base-calling of automated sequencer traces using phred. II. Error probabilities. Genome Res. 1998, 8 (3): 186-194.PubMedView ArticleGoogle Scholar
  20. Gordon D, Abajian C, Green P: Consed: a graphical tool for sequence finishing. Genome Res. 1998, 8 (3): 195-202.PubMedView ArticleGoogle Scholar
  21. Lowe TM, Eddy SR: tRNAscan-SE: a program for improved detection of transfer RNA genes in genomic sequence. Nucleic Acids Res. 1997, 25 (5): 955-964. 10.1093/nar/25.5.955.PubMed CentralPubMedView ArticleGoogle Scholar
  22. Thompson JD, Higgins DG, Gibson TJ: CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 1994, 22 (22): 4673-4680. 10.1093/nar/22.22.4673.PubMed CentralPubMedView ArticleGoogle Scholar
  23. Zhang Z, Li J, Yu J: Computing Ka and Ks with a consideration of unequal transitional substitutions. BMC Evol Biol. 2006, 6: 44-10.1186/1471-2148-6-44.PubMed CentralPubMedView ArticleGoogle Scholar
  24. Kumar S, Tamura K, Nei M: MEGA3: Integrated software for Molecular Evolutionary Genetics Analysis and sequence alignment. Brief Bioinform. 2004, 5 (2): 150-163. 10.1093/bib/5.2.150.PubMedView ArticleGoogle Scholar
  25. Felsenstein J: PHYLIP-phylogeny inference package (version3.2). Cladistcis. 1989, 5: 164-166.Google Scholar
  26. Ronquist F, Huelsenbeck JP: MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics. 2003, 19 (12): 1572-1574. 10.1093/bioinformatics/btg180.PubMedView ArticleGoogle Scholar
  27. Tajima F: Simple methods for testing the molecular evolutionary clock hypothesis. Genetics. 1993, 135 (2): 599-607.PubMed CentralPubMedGoogle Scholar

Copyright

© Cui et al; licensee BioMed Central Ltd. 2007

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Advertisement