Open Access

Construction of a BAC library and mapping BAC clones to the linkage map of Barramundi, Lates calcarifer

  • Chun Ming Wang1,
  • Loong Chueng Lo1,
  • Felicia Feng1,
  • Ping Gong1,
  • Jian Li1,
  • Ze Yuan Zhu1,
  • Grace Lin1 and
  • Gen Hua Yue1Email author
BMC Genomics20089:139

DOI: 10.1186/1471-2164-9-139

Received: 07 September 2007

Accepted: 25 March 2008

Published: 25 March 2008

Abstract

Background

Barramundi (Lates calcarifer) is an important farmed marine food fish species. Its first generation linkage map has been applied to map QTL for growth traits. To identify genes located in QTL responsible for specific traits, genomic large insert libraries are of crucial importance. We reported herein a bacterial artificial chromosome (BAC) library and the mapping of BAC clones to the linkage map.

Results

This BAC library consisted of 49,152 clones with an average insert size of 98 kb, representing 6.9-fold haploid genome coverage. Screening the library with 24 microsatellites and 15 ESTs/genes demonstrated that the library had good genome coverage. In addition, 62 novel microsatellites each isolated from 62 BAC clones were mapped onto the first generation linkage map. A total of 86 BAC clones were anchored on the linkage map with at least one BAC clone on each linkage group.

Conclusion

We have constructed the first BAC library for L. calcarifer and mapped 86 BAC clones to the first generation linkage map. This BAC library and the improved linkage map with 302 DNA markers not only supply an indispensable tool to the integration of physical and linkage maps, the fine mapping of QTL and map based cloning genes located in QTL of commercial importance, but also contribute to comparative genomic studies and eventually whole genome sequencing.

Background

Barramundi (Lates calcarifer), also called Asian seabass or the giant sea perch, belonging to the family Latidae is widely distributed in the coast and freshwater of the tropical Indo-west Pacific, from the Persian Gulf to India and Northern Australia [1, 2]. Because of good meat quality and relatively high market value of L. calcarifer, it has become an attractive commodity of both large and small-scale aquaculture enterprises. It is commercially cultivated in Thailand, Malaysia, Singapore, Indonesia, Hong Kong, China and Australia in both brackishwater and freshwater ponds, as well as in cages in coastal waters. The global annual production of L. calcarifer was 400,000 MT according to FAO statistics. However, detailed breeding programs for genetic improvement of Asian seabass are still quite rare [3]. Identification of genomic regions and genes responsible for economically important traits could facilitate genetic improvement through marker-assisted selection [4], which is of importance for future aquaculture of L. calcarifer.

Linkage and physical maps are indispensable tools needed to identify genomic regions responsible for traits of interest. The genome of L. calcarifer is very compact (only 700 Mb) consisting of 24 chromosome pairs [5]. The first linkage map for L. calcarifer containing 240 microsatellite markers and genes on 24 linkage groups [6] was applied to mapping QTL for growth traits [7]. Libraries with large genomic DNA inserts are essential for physical mapping and positional cloning, particularly for higher eukaryotes [8]. The BAC (bacterial artificial chromosome) cloning system has become an invaluable tool in genomics studies because of its ability to stably maintain large DNA fragments and its ease of manipulation [9]. Genomic inserts in BAC clones have been shown to be very stable in E. coli and thus serve as ideal templates in generating whole-genome physical maps by DNA fingerprinting, developing sequence-tagged connectors and shotgun sequencing [1012]. These features make the BAC cloning system a popular choice for high-throughput genomics studies [13]. BAC libraries have been developed for many economically important animal species such as cattle [14], pig [15], and sheep [16] and the highly endangered giant panda [17]. Only currently, BAC libraries were produced for some commercially important fish species such as salmon [18], catfish [12], rainbow trout, carp and tilapia [19].

Here, we describe the construction and characterization of a BAC library covering 6.9 times L. calcarifer haploid genome and mapping of 86 BAC clones to the linkage map. The BAC library and the improved linkage map of L. calcarifer will facilitate the integration of physical and linkage maps, fine mapping of QTL and identification of genes located in QTL of interest, maker-assisted selection and genome research.

Results

Library construction

A BAC library of L. calcarifer was constructed using the HindIII cloning site in commercially prepared pCC1BAC vector (Epicentre, MD, USA). The BAC library consisted of a total of 49,152 clones, which were manually arrayed into 128 384-well plates.

Insert size distribution

To examine the quality of the BAC library, the sizes of 212 BAC clones randomly picked from the library were determined. All the 212 clones contained inserts. The insert size distribution of these 212 clones is shown in Figure 1 and 2. The average insert size was 98 kb, ranging from 45 to 200 kb. The insert size of over 80% of the BAC clones in this library was larger than 80 kb, and the insert size of 50% clones was smaller than 100 kb. This BAC library provides 6.9 time haploid genome equivalent based on a genome size of 700 Mb [6].
https://static-content.springer.com/image/art%3A10.1186%2F1471-2164-9-139/MediaObjects/12864_2007_Article_1333_Fig1_HTML.jpg
Figure 1

DNA analysis of 31 random BAC clones from the L. calcarifer Hin dIII BAC library by pulse-field gel electrophoresis. DNA samples digested with NotI were separated on 1% agarose gel in 0.5 × TBE buffer for 16 h under the following conditions: ramp pulse time of 5–15 s at 6 V/cm, temperature at 14°C. Markers used are Lambda Ladder PFG Marker (outside lanes) and MidRange II PFG Marker (NEB, SG, Singapore). The 8 kb common band is the pCC1BAC Vector (Epicentre, WI, USA).

https://static-content.springer.com/image/art%3A10.1186%2F1471-2164-9-139/MediaObjects/12864_2007_Article_1333_Fig2_HTML.jpg
Figure 2

Insert size distribution of 212 L. calcarifer BAC clones. DNA samples of the 212 clones randomly picked from the L. calcarifer HindIII BAC library were analyzed and grouped. Results indicate that the average insert size is 98 kb with over 80% of the clones > 80 kb.

BAC library screening

To further assess the quality of this BAC library, 24 microsatellite markers randomly selected from each of the 24 linkage groups were used for hierarchical screening. PCR-screenings with the 24 microsatellite markers resulted in the number of positive clones varying from 3 to 15 with an average of 6.6 (Table 1) (see example of the PCR screening in Figure 3). PCR screening with these 15 ESTs/genes (PVALB-1, 5-HT, PROL-A, 14KDA-AP, AMY-A, MX, AP, LECT2, LYSO-G, IGF-1, TUB1A, TUB2B, GT7, CYP19A2 and AFPII) revealed that the number of positive BAC clones varied from 3 to 14 with an average of 7.3 (Table 2). The actual average number of positive BAC clones detected by screening with microsatellites and ESTs/genes was near to theoretically calculated number of genome coverage (i.e. 6.9 time coverage of the haploid genome). At least 3 positive BAC clones for each of the ESTs/genes were identified from the library.
Table 1

Screening of the BAC library with 24 microsatellites located on each of the 24 linkage groups of L. calcarifer

Linkage group

Locus

GenBank accession no

Forward primer (5'-3')

Reverse primer (5'-3')

PCR Ta (°C)

Positive clone number

LG1

Lca318

DQ290175

TCCCACCCCAGTCCAGAAA

TACCAGAGCCTGAAACACAGTAGG

55

6

LG2

Lca064

AY998856

AGGCATATGCACCTCACAAGAGTG

CCCACGGTTTATTTATCTGTCATTATC

55

15

LG3

Lca137

DQ290039

CGCCTTAAATCTCTACGCTCTGG

TCGCATGCTGTAATTAAGGTGGTA

55

5

LG4

Lca171

DQ290065

ATTGCGTTACCAAGAGGTGAA

TGTCTTTGAAGGCTGAAAACTG

55

8

LG5

Lca098

AY998880

CAAAGGGGCCACTGCACATAAT

CTCCAGCTCACCCAGGTTCACT

55

5

LG6

Lca062

AY998854

AGGATGGCACGCTGAAACTATCG

ATAAGCTTGTACAGGGGCTGAGTGC

55

3

LG7

Lca130

DQ290035

GAGGCTCCCAATCCCAACAA

GGAGGCAGACGAGGAAGGAA

55

13

LG8

Lca086

AY998873

AAATGGCCTTCCTGTCCCTTCAG

GTGTTCCCTTGTTCTGCCACAGTG

55

4

LG9

Lca301

DQ290166

GCCAGTGTGAGGGACAGAGA

GGGCCTTGTTTTGCTTTTG

55

9

LG10

Lca002

AF007943

GCCGCTTGTTTACCAGTAAA

TCCATTTGAGGATTAACAGC

55

5

LG11

Lca058

AY998850

AAACAGGCAGCCAGATAGACAGAG

AAGAGGTGGTGGGACTAATTTGAGA

55

13

LG12

Lca074

AY998863

CATCATTTACACTCTGTTTGCCTCAT

GACAGACAGGTGTTTTAGCCTATTTG

55

6

LG13

Lca253

DQ290129

TGGGGACTTGACTTCCTTTTATG

TACCGAGGTTGGATGGTTTTCT

55

3

LG14

Lca147

DQ290047

TGCCCCTAATGTATTCTTTCCACT

GCTCCCACCTCTCATTCATTATTC

55

5

LG15

Lca069

AY998859

GCCTTTCTGTTTTCTGATTTATCTTCAT

AACACCCCGAAATACTGCTACTACAG

55

4

LG16

Lca367

DQ290206

TGTATTACAATGCCCGTGGTCA

TTAAGCCTTTGGTGTCTCAGTGTG

55

10

LG17

Lca021

AF404083

GTGCCACCTGCCTGACC

GCCATGACTGATTGCTGAGA

55

4

LG18

Lca193

DQ290082

CCTCTGCCTTTTCATCTATATTGC

CACATCGCACAAATGGACTGA

55

9

LG19

Lca220

DQ290104

ATGGCTGTGAAAAGACTGGTATCT

CGCCCCTCACTCAACAGAG

55

5

LG20

Lca181

DQ290073

CACTGGGTGGCGTTTGTATTAGC

CAAGAATTGGGATTTTGCTGTGC

55

8

LG21

Lca255

DQ290131

AGAGACACTTTATACGGGGACATC

GTAAACTGAAGCAAGCCAAACCT

55

7

LG22

Lca040

AF404099

TGAGGAAGCATCAGCTGTAATCA

CAGGACGCAAACACTGAAAT

55

3

LG23

Lca411

DQ290221

GTGGTGCAGCGGTTGCTCTC

CCGACTCATGCTGCTTTTCGTAAT

55

5

LG24

Lca231

DQ290112

GGCCAGGTTAATCAAGAC

ACTAGACTGCAATCAAACACA

55

3

Ta: annealing temperature for PCR.

Table 2

Screening of the BAC library with 15 genes/ESTs of L. calcarifer

Locus

GenBank accession no

Primer (5'-3', forward)

Primer (5'-3', reverse)

PCR Ta (°C)

PCR product length (bp)

Positive clone number

PVALB-1

AY688372

ATCGTCCGTCCGTTTCCCATAAAA

TGACCTTTCACCTCCCTCCAGACC

55

261

5

5-HT

EU136181

CTGCTCGGCGCGCTCAT

TCCATCCTGCACCTGTGCG

60

200

8

PROL-A

EU136180

GTGCAGAGCCGTCSCCATCA

TTCAGGAAGCTGTCRATCTTGTG

55

500

5

14KDA-AP

EU136179

CCGGGGACAGACAACTCGCTTTCAGAGA

ACAGGTTGGTGAGCTCCAGTTGGTGTTC

55

500

4

AMY-A

AY007592

GGTCGCTTTCCGTAATGTGGTCAA

ACCGGGCATGCCAGTGTTCA

55

250

9

MX

Ay821518

TCATTGATAAAGTGACAGCATTCA

CCAATATCCTTGAGTTTCTTGACA

55

400

7

AP

AJ888375

GACGCCCTCCTCTCCTCTCA

TTTCGACAGCCATCTCTGAACATA

55

700

4

LECT2

EU136177

TTTTTGATCTGAAGATGAGACGTGTCATC

GATCAGATCCCGAGCAGGTCAATC

55

1000

3

LYSO-G

EU136178

AGAGTCCAGGGCTGGAAAT

CCCTCAGAAACTTTAGTTGTGAAC

55

600

9

IGF-1

EU136176

CAGTGGCATTTATGTGATGTC

CCTCGACTTGAGTTTTTCTG

55

503

3

TUB1A

EU136175

GGCACTACACAATCGGCAAAGAGA

TCAGCAGGGAGGTAAAGCCAGAGC

55

144

11

TUB2B

EU136174

GTACAGACGGGGGAAGGGGACCAT

TTCCGCACCCTCAAACTCACCACA

55

160

13

GT7

EU136172

CAGGGTGATCACGCAGTGC

GGCAATCCGACAGCCAGAG

55

156

6

CYP19A2

AY684259

GCTCACCGCCTATAGCCAAAGAA

GGCCGAGTCCTGCCAAGAAA

55

505

8

AFPII

EU136173

TCCCTCCTGTGAAATTGGTTGG

AGGGACGCTGGCACAGACTG

57

1500

14

Ta: annealing temperature for PCR.

https://static-content.springer.com/image/art%3A10.1186%2F1471-2164-9-139/MediaObjects/12864_2007_Article_1333_Fig3_HTML.jpg
Figure 3

Hierarchical PCR screening of the superpools and pools of the BAC library of L. calcarifer. A First round PCR screening in 11 superpools representing the entire library or 128 384-well microtiter plates. Lanes 1–11: superpools 1–11 and lane 12: genomic DNA as positive control. Each superpool contains DNA of 12 plates or 4,608 individual BAC clones. In five superpools (3, 4, 8, 9 and 10), PCR product was amplified by the marker Lca064. B Second round PCR screening in 48 pools from the superpool number 3. Three pools (6, 35 and 41) showed a signal amplified by the marker Lca064. C Third round PCR screening in a 96-well plate from the pool number 6. Three positive clones (26, 29 and 86) were detected in the plate by the marker Lca064.

Microsatellite isolation from BAC clones and linkage mapping

In order to map BAC clones to the linkage map for future integrating linkage and physical maps, we isolated microsatellites from 300 BAC clones through enrichment of microsatellites. 864 clones collected from the microsatellite-enriched library were sequenced in both directions. 451 clones contained microsatellites (CA > 7 or GA > 7), yielding 229 unique sequences containing microsatellites. Among the 229 sequences, 218 had enough flanking regions for primer design. Primers were designed for 218 microsatellites, among which 63 within 63 BAC clones were informative in the mapping panel used for linkage mapping. 62 were mapped to 24 LG (Figure 4, 5, 6 and 7) while one marker LcaB044 remained unlinked, making the total number of mapped markers on the L. calcarifer linkage map to be 302. At least one BAC based marker was mapped on each LG. Thus, together with 24 microsatellites located in different BAC clones and used for screening the BAC library, a total of 86 BAC based markers have been anchored on the linkage map with at least one on each LG. The male maps of LG14 and LG18, which were split to two LG on the first generation map respectively [6] due to the limited number of markers, were merged to one LG respectively by integrating new microsatellites located in single BAC clones (Figure 6). Details about primer sequences, GenBank accession number, annealing temperature for PCR, PCR product size and locations of the 63 markers located in different BAC clones are summarized in Table 3.
Table 3

Microsatellites isolated from BAC clones and mapped on the linkage map of L. calcarifer

Orginal order

Linkage group

Locus

GenBank accession no

Motif

Forward primer (5'-3')

Reverse primer (5'-3')

PCR Ta (°C)

Product Length (bp)

Location in the library (384plate-96plate-well)*

1

LG1

LcaB003

EU072356

(GT)14

CCTCATACTTGCATCAACATAATA

ATCAAAACCGGCTTCATCT

55

113

128-P2-A3

2

LG1

LcaB030

EU072367

(CA)27

TTCTCCCCGTGCCCCTTTGTA

AGCCCACTCCCCTGAGATGAGC

55

158

128-P2-B8

3

LG2

LcaB128

EU072400

(GT)16

AGTCGGCCTGTGCAATAAGAT

CAGCAGTTTGGGAATAATGACATA

55

262

128-P1-E4

4

LG3

LcaB002

EU072355

(GT)10

TTGGCTGTATTCCTCCTGTCTTGT

TTGGCTCTTTACGCTCAATACTCA

55

182

128-P2-A4

5

LG4

LcaB012

EU072359

(CA)9

GTGGGGTGTCCTGGCTCCTC

TCCCATCTCCTCCTGCTGTTTCT

55

329

128-P2-B11

6

LG4

LcaB014

EU072361

(GT)16

GCAGACCCGCTTTTTATTCAT

GTCCCCTCTGCTCCAGTGTT

55

181

128-P2-C12

7

LG4

LcaB052

EU072376

(CA)10

ATCATGACCCACAAGAGGAGAG

TCAGGGATAGAGACTTGTGAATGA

55

146

128-P2-A5

8

LG4

LcaB053

EU072377

(GT)18

GAGGCCCCGATGAGAAAACCTG

TGATGTCGGCGGAGGAGTGC

55

319

128-P2-H11

9

LG5

LcaB034

EU072369

(CA)8

TTTGCCTGAATAAAACCCTACACT

AAGCCCTTTGCACAGTATTATTTC

55

171

128-P2-C8

10

LG5

LcaB084

EU072391

(GT)14

GAGCGCTCGGCTGTTTCATC

CAGCCAATCTGTTTACCAGCACAC

55

248

128-P2-C4

11

LG5

LcaB086

EU072392

(CA)12

CAGATGATCTTTGACGAACTGAAA

TTCTTGGTGAAAAATGACAACAAA

55

157

128-P3-C5

12

LG5

LcaB130

EU072401

(CA)26

GGGGGAAAGGAAAAACTGATG

TGTAATGGTAAGATTTTGGGTGTG

55

215

128-P2-F6

13

LG5

LcaB177

EU072409

(GA)13

TTTAATTTTAGCCCCGTGATT

GTGTGCCAGTGGGTTTCTC

55

214

128-P3-C1

14

LG5

LcaB180

EU072410

(TC)13

AGTCTACACCGATTACACCAGTCT

ACTCTAACCGCACCAGAAAAG

55

243

128-P2-C7

15

LG5

LcaB229

EU072417

(GT)14

ACATCGCGTTCTCCTCTGAT

CCAGGGTGTGGTAGTCCTCTC

55

140

128-P3-C8

16

LG6

LcaB065

EU072384

(GT)13

GCATTGTTGGCAAAGTTGAGTAT

TCTTACAGTGGGCATCTGACCT

55

148

128-P3-G1

17

LG6

LcaB188

EU072411

(GA)17

TGATTTGGCTTTTAGGTGAAACA

TGACAAAAGAATGCCTTGCTCT

55

211

128-P3-D7

18

LG7

LcaB010

EU072358

(CA)9

TCCTCCTGGGCTGTTGTATCTTAT

ATGGGGTGGACCTCATTTTCA

55

155

128-P1-G10

19

LG7

LcaB072

EU072385

(GT)10

CAACGTGGGTGAATCTGTGT

TTGGCAGCAAATAATTCAGAGTAT

55

217

128-P1-A11

20

LG7

LcaB114

EU072395

(AC)8

TGTGCCCATGTTTACTAGATACCA

GTGTGCACGCTGCATTTGT

55

172

128-P2-F9

21

LG7

LcaB135

EU072402

(TC)18

CATCCCAGGTTTTCATACCATT

ACTGCGGTTATTAATCCACAAAG

55

123

128-P3-C4

22

LG7

LcaB151

EU072404

(TC)11

TTGTGCGCTTCTGTTTGTTTTTCT

GTAGGGCTATGCTGTTGGCTTTCT

55

311

128-P2-D2

23

LG8

LcaB025

EU072366

(GT)13

AGGGGGCAAAGGGGTCACG

GAGCCGGCAGTTGCACATCTG

55

160

128-P2-B3

24

LG8

LcaB083

EU072390

(GT)12

CGCTGGCATGGCTCTAGTAGTGAT

AGCGGGCTAAAAGCTGCTGTG

55

366

128-P1-H5

25

LG8

LcaB214

EU072413

(GA)12

AGCGGGAGGCTGAGAAGTAA

ACCCCTGCCTCTTGTTCATC

55

239

128-P1-H4

26

LG9

LcaB024

EU072365

(GT)10

AGAAGGGAAAAAGAGATGGGATGT

CAGGGCCGTTTTATTGCTGTAG

55

162

128-P3-B2

27

LG9

LcaB045

EU072373

(GT)26

ACAGGGAACGAATGGGGACAA

AAATTGGCACGCTCATTCAAGAAC

55

149

128-P2-D4

28

LG9

LcaB155

EU072405

(GA)24

TGTGGCCTTTGTGTAAGTGAGAA

TCATTCCCGCAAACAACACA

55

197

128-P3-G11

29

LG10

LcaB160

EU072406

(GT)13

CTTCATCCAGCCCAGTGACAG

GAATGGCCAGCTAAAACATCAAC

55

307

128-P3-A1

30

LG10

LcaB201

EU072412

(TC)16

ATTGCACCAGTCCCGAATGAG

GCAGCGTGCTTGTGGAAAAA

55

210

128-P2-D1

31

LG11

LcaB112

EU072394

(GT)7

TACCTGCCTTGTTTTTGTCCTTA

AAGCCTCCATACACAGCTACATTA

55

113

128-P1-D6

32

LG12

LcaB041

EU072371

(AC)8

AGGTATGTTTTTGGGGCTTTTAGT

CCCCCTACCCCTGTTTTACATA

55

250

128-P1-B5

33

LG12

LcaB058

EU072381

(AC)15

AAACCAAATGCTTACACAGTTACC

TTGAGAGCTATTGGGATTACACAT

55

160

128-P1-A2

34

LG13

LcaB059

EU072382

(AC)18

CCTAGCCAAGTGCAACAGTGTG

AGCTGGGAAACAGGCTGAGAC

55

186

128-P3-A12

35

LG14

LcaB055

EU072379

(AC)12

AGTTGCGGTCTTGTCCAAATGG

ACTGGCAGAGTCAAGCAAAGTGTG

55

325

128-P3-A3

36

LG14

LcaB075

EU072386

(GT)12

TGTCGCACACCGCTGCTTTACTAT

CTTGCTCTCACCCTCTCCCTCTTT

55

131

128-P2-G12

37

LG14

LcaB076

EU072387

(AC)17

CGAAAACGTCGATCCAACTAAA

ACAGTCAGTGCGTGAAGTGTATG

55

135

128-P3-A2

38

LG14

LcaB127

EU072399

(AC)11

AGTTGCAGGGCATGCTGTGAAAC

TCGGCATCAAGCGTGGAAGAG

50

159

128-P2-D6

39

LG15

LcaB174

EU072408

(GT)8(GA)15

CAGCATTAAAAAGATGAGAAAAGT

ATTCCCCCATCTTTGTTACAGTT

55

242

128-P2-D7

40

LG16

LcaB013

EU072360

(AC)15

AGGCCAAGGCTGCTCTGTGTC

CAACCTGGGATGAGGCACTAAAAG

55

127

128-P2-B12

41

LG16

LcaB054

EU072378

(AC)8

TGCAGGAGATAAGACGCTGTG

GAGATCGGCAACCTGACAAA

55

298

128-P3-F4

42

LG16

LcaB062

EU072383

(AC)15

ATGAGGGGTGAACAGTTGTCCT

TCTCCTCGTCCTTTTCGTTACC

55

218

128-P3-F8

43

LG16

LcaB078

EU072388

(GT)13

GTTACCATGCCAACAACCAA

TAGCCTGCTATAGATCCCACTG

55

81

128-P3-A4

44

LG16

LcaB228

EU072416

(AC)21

GAATAGGCCTACCTGGTGAGAGG

TCCCTGCTTAGCTGCCATTATC

55

237

128-P2-B12

45

LG17

LcaB023

EU072364

(GT)13

GCAGCGAGATGAACAGTGATTATT

ACATGATCCTCGCCACCATC

55

326

128-P2-G5

46

LG17

LcaB048

EU072374

(GT)20

TGGAGCTTTATTTGAGTGTGAC

CCCCCTATGTATTCAGTATTCTG

55

180

128-P3-C4

47

LG17

LcaB051

EU072375

(GT)19

TACCCAAAGTAAACCAGCAGCACA

CAACTAGCAGGTTTGCACAACACA

55

104

128-P3-H11

48

LG17

LcaB121

EU072397

(AC)16

CTTTTTGTGCCCCAGATGACG

GGAGCAGAGTGGAGCTTTCAGAA

55

238

128-P1-D9

49

LG18

LcaB019

EU072363

(GT)11

TTGAGTCCCCTGTGCTATGTAACA

CACCGCCTCCACAATTAGTGTC

55

199

128-P1-F10

50

LG18

LcaB081

EU072389

(GT)7(GCA) (GT)3

TGAGGACAGCCACCCCACTTTT

GAGCCGCTATCTCATTCCCACATC

55

126

128-P2-F10

51

LG18

LcaB221

EU072415

(TC)9

AGGGGAGTGCTGCCTCAGTG

TTCCCAACAGATAATGATGCTCAA

55

117

128-P3-A8

52

LG19

LcaB005

EU072357

(AC)22

AGGCGGTGCTGGGGCAGAT

TTACCGCAGCCTGGCTAGAGGTCT

55

300

128-P3-H8

53

LG19

LcaB033

EU072368

(AC)15

ATCCACCTTGAGGTTTCTTTATCA

AACCAAGCCACTCCTATCATCTT

55

190

128-P1-D5

54

LG20

LcaB219

EU072414

(GA)25

AGTTGGCTCTTAAAGCATTTGAAT

TTCCCACACCGTTAGGTTTATCTG

55

155

128-P1-H12

55

LG21

LcaB106

EU072393

(GT)7

CTGGCTGCATGGAGAAAGAAGT

TTGGGTTTTGAGCTCACTGACA

55

311

128-P2-F7

56

LG21

LcaB116

EU072396

(GT)20

CATGGCCTTTCTGGGAAGTTATTG

CAGACGGAGCCACAAGCAAAAC

55

226

128-P3-D6

57

LG21

LcaB169

EU072407

(AC)6(GA)20

CACAAACCAGGCGATCACATATCG

GTAAGCCCGCAGAAATCGACTTCA

55

218

128-P3-E9

58

LG23

LcaB015

EU072362

(GT)11

GAGCGCTCTCCCCTGGTTTC

TGCAGCCGAGCACGACTG

55

221

128-P1-G9

59

LG23

LcaB038

EU072370

(GT)19

TGTGCGCACTCACATACATTAG

TGAAAAATAGATGGTAAGCCTCTC

55

216

128-P1-A3

60

LG23

LcaB056

EU072380

(AC)11

ATGCCGTTTCCTGCTGCTGTC

TGATGCTGTTTCTGGCTGGTGTA

55

141

128-P2-E02

61

LG23

LcaB150

EU072403

(GA)11

TCTAGCGCTCGTCCTCTCCTG

AGGCCTCCTCGTTCTCTGCT

55

178

128-P2-A11

62

LG24

LcaB125

EU072398

(GT)12

AAGCACAAGATACGCCTTCCTT

GTGCCCTGGGCCTCTACAT

55

153

128-P2-C11

63

Unlinked

LcaB044

EU072372

(GT)15

CAGGACGTTTGAATACTTGTGT

TTAAAAGGTGGTGGTATTAGTCAT

55

160

128-P2-A8

Ta: annealing temperature for PCR. * 384plate-96plate-well: name of the 384-well plate, name of 96-well plate and well position in the 96-well plate.

https://static-content.springer.com/image/art%3A10.1186%2F1471-2164-9-139/MediaObjects/12864_2007_Article_1333_Fig4_HTML.jpg
Figure 4

A microsatellite linkage map of L. calcarifer anchored by 86 BAC clones-LG 1–6. F: linkage map for female. M: linkage map for male. Markers underlined represent microsatellites selected from each LG for screening the BAC library. Markers in italic (initiated with LcaB) represent microsatellites isolated from BAC clones and newly mapped to the map.

https://static-content.springer.com/image/art%3A10.1186%2F1471-2164-9-139/MediaObjects/12864_2007_Article_1333_Fig5_HTML.jpg
Figure 5

A microsatellite linkage map of L. calcarifer anchored by 86 BAC clones-LG 7–12. See detailed explanation in Figure 4

https://static-content.springer.com/image/art%3A10.1186%2F1471-2164-9-139/MediaObjects/12864_2007_Article_1333_Fig6_HTML.jpg
Figure 6

A microsatellite linkage map of L. calcarifer anchored by 86 BAC clones-LG 13–18. See detailed explanation in Figure 4

https://static-content.springer.com/image/art%3A10.1186%2F1471-2164-9-139/MediaObjects/12864_2007_Article_1333_Fig7_HTML.jpg
Figure 7

A microsatellite linkage map of L. calcarifer anchored by 86 BAC clones-LG 19–24. See detailed explanation in Figure 4

Discussion

A critical tool for genomic studies in fish species is the availability of deep-coverage large-insert genomic libraries, such as BAC libraries that can be used for physical mapping, integration of linkage and physical maps, positional cloning, comparative genomic studies and genome sequencing [13]. We constructed the first BAC library for L. calcarifer containing 49,152 clones with an average insert size of 98 kb ranging from 45 to 200 kb, indicating that this BAC library provided 6.9 × coverage of the L. calcarifer haploid genome. We have noticed that 50% of the inserts in our BAC library were under 100 kb. It is common that insert size of 50% of BAC clones was smaller than the size of DNA fragments recovered from gels. This phenomenon has been seen in several BAC libraries, such as the BAC library of tomato [13]. The reason for this is that smaller fragments could be included in larger fragments during electrophoresis, and during ligation, the relatively smaller fragments were preferentially ligated to the vectors. PCR screening of the library with 24 markers each from one of 24 LG and 15 randomly selected ESTs/genes demonstrated that the BAC library provided good coverage of the L. calcarifer genome. Whether the BAC clones with large inserts were of hybrid origin remains to be examined.

A second generation linkage map of L. calcarifer is under construction by integrating new markers including microsatellites, ESTs and candidate genes onto the first generation map. Low polymorphism of ESTs and candidate genes was a bottleneck to map them to the linkage map [6]. Using highly polymorphic microsatellites located in BAC clones harboring interesting genes and ESTs, these interesting genes and ESTs could be mapped onto the linkage map as shown in this experiment. By employing highly polymorphic microsatellites in BAC clones, we have mapped 86 BAC clones to the linkage map of L. calcarifer. At least one BAC clone has been anchored on each LG, which can be used to integrate linkage and physical maps in the future. The number of markers on the linkage map of L. calcarifer increased to 302 by mapping 62 novel microsatellites located in 62 BAC clones onto the map. The two male linkage groups (i.e. LG14 and LG18) which were split to two LG on the first generation map respectively [6] due to the limited number of markers on these LG, were merged to one LG respectively by integrating new microsatellites located in single BAC clones, which improved the quality of the linkage map of L. calcarifer.

The BAC library of L. calcarifer could be also used in constructing a physical map by BAC fingerprinting [12, 20], sequencing BAC ends and positional cloning of QTL of commercial interests [4] so as to facilitate selective breeding of L. calcarifer. Eventually, the BAC library can be used in whole genome shotgun sequencing when it becomes necessary.

Conclusion

A first L. calcarifer BAC library with 6.9 × coverage of the haploid genome has been constructed and characterized. Screening the library with 24 markers and 15 ESTs/genes demonstrated good genome coverage of this library. Eighty-six BAC clones were mapped to the first generation linkage map, improving the marker density of the linkage map of L. calcarifer. This BAC library together with the improved linkage map not only supplies an indispensable tool to physical mapping, integration of physical and linkage maps, and positional cloning for genes of importance, but also contributes to comparative genomic studies and eventually genome sequencing.

Methods

Preparation of high-molecular-weight DNA

Five hundred microliters of blood was collected from a male individual of L. calcarifer with a heparinized syringe. The concentration of leucocytes was quantified to be approximately 109 cells/ml. Quantities corresponding to 2.14 × 107 cells were embedded in 40 μl of 2% InCert agarose (in PBS) for DNA extraction. The mixture was then transferred into ice-cold plug moulds (Bio-Rad, SG, Singapore). Individual plugs were released into cell lysis solution [1% lithiumdodecyl sulfate, 10 mM Tris (pH 8), 100 mM EDTA (pH 8)] that was incubated at 37°C for 1 hr with occasional swirling. The cell lysis solution was replaced with 50 ml of new cell lysis solution and incubated overnight at 37°C. The cell lysis solution was supplanted with 50 ml of 20% NDS. Two ml of proteinase K (20 mg/ml) was added to each 50 ml of 20% NDS consisting of 0.2% N-laurylsarcosine, 2 mM Tris-HCL (pH9.0), 0.14 M EDTA. The solution was incubated at 37°C overnight. Plugs were washed three times with TE50 and 0.05 M EDTA for one hour at room temperature. The plugs were put into a fresh Falcon tube, and washed twice with 50 ml TE50 and 50 μl PMSF (100 mM) at 37°C for 20 min to inactivate proteinase K. The plugs were then washed twice with 50 ml of TE50 in the Falcon tube at room temperature for 30 min to get rid of the PMSF.

Partial digestion of high molecular weight DNA and size selection

Digestion with restriction enzyme HindIII, pulse field gel electrophoresis (PFGE), isolation and purification of high molecular weight (HMW) DNA were performed using the method described previously [21]. Briefly, after displacement of the plugs by 1 × TE buffer, the agarose plugs were soaked in 800 μl of HindIII digestion buffer [0.015% bovine serum albumin (BSA), 75 mM NaCl, 12 mM Tris-HCl (pH 7.50)] and 3 U of HindIII for 16 hours at 4°C, after which, 100 μl of MgCl2 (100 mM) was added and the mixture was incubated at 37°C for one hour to partially digest the genomic DNA. The reaction was stopped by adding 150 μl of 0.5 M EDTA (pH 8.0), 15 μl 20 mg/ml proteinase K and 37.5 μl 20% NDS, and incubating at 37°C for one hour. Plugs were rinsed in TE50 in a Petri dish then transferred to a 15 ml Falcon tube. 15 ml of TE50 and 15 μl of 100 mM PMSF were added to the tube. The tube was incubated at room temperature for 20 min on rotating shaker. The tube with plug was washed twice with 15 ml TE50 at room temperature on a shaker for 30 min each.

Size selection was carried out as described [22], with minor modifications. In brief, partially digested DNA was separated by PFGE in 0.5 × TBE on a CHEF-DRII apparatus (Bio-Rad, SG, Singapore) under the following conditions: 14°C, 6.0 v/cm, angle = 120°, initial switch time = 5 sec, final switch time = 15 sec, run time = 16 hours and ramping = linear. At the end of this electrophoresis step, the gel portion containing DNA of 50 kb or less in size together with the portion of the gel containing the original plugs was removed. 1% fresh agarose was added to the remaining gel followed by a second electrophoresis step using the same conditions for 18 hours. Gel slices containing size fractionated DNA were obtained by cutting horizontally at 0.5 cm intervals in the size range of 100–250 kb. Each excised gel slice was subsequently inverted and buried in 1% low-melting-point agarose gel. A third electrophoresis step using the same conditions for 18 hours was carried out to concentrate the widely spread DNA fragments in each gel slice into a sharp single band. The band of size selected genomic DNA was then excised and dialyzed in 1 × TAE at 4°C overnight.

Ligation and electroporation

Size fractionated DNA was recovered from each gel band by electroelution in Spectra/Por 7 dialysis bags (Spectrum Laboratories, CA, USA) as described [23]. Partially digested HMW DNA was then ligated to 25 ng of dephosphorylated, HindIII digested pCC1BAC (Epicentre, MD, USA) at a 1:10 molar ratio of insert to vector with 400 units of T4 ligase (NEB, MA, USA) in 50 μl reaction at 16°C overnight. Dialyzed ligation was used to transform ElectroMAX DH10B competent cells (Invitrogen, MD, USA). Electroporation was carried out using a BioRad Gene Pulser (BioRad, CA, USA) at 4 kΩ and 350 V. Cells were incubated in 1 ml SOC medium at 37°C for one hour with shaking and later spread on LB plates containing 12.5 μg/ml Chloramphenicol, 40 μg/ml X-gal and 100 μg/ml IPTG and incubated at 37°C for 24 hours to allow the blue color to develop sufficiently.

Isolation of BAC DNA and estimation of insert size

We isolated BAC DNA from 212 BAC clones randomly chosen using a QIAwell 8 Plasmid Kit (Qiagen, HRB, Germany) following the protocol of the manufacturer. Isolated BAC DNA were digested with the restriction enzyme NotI and then subjected to PFGE for 16 hours using the same PFGE conditions as those for high molecular weight DNA isolation.

Library pooling and PCR screening

White recombinant colonies were manually picked and arrayed to plates (Genetix, Hampshire, UK) of 384-well each containing of 60 μl of LB media and 25% glycerol. Plates were incubated overnight at 37°C and stored at -80°C. The frozen stocks of the primary clones in 384 well plates were recovered and transferred to 4 96-well PCR plates containing 100 μl LB medium supplemented with 15% glycerol and 12.5 μg/ml chloramphenicol, then incubated overnight at 37°C to make a copy of the BAC library.

To establish a hierarchical PCR screening system, the library was divided into 11 superpools each consisting of 12 plates of 384-wells. Each superpool was divided into 48 pools each consisting of one 96-well plate of BAC clones. Cultures from 48 pools were combined to make superpool DNA for the first step PCR screening. Cultures from 48 plates of 96-well BAC clones were combined to make pool DNA for the second step PCR screening. In each pool, cultures from each well of 96 clones from a 96-well plate were used for the third step screening.

For examining the genome coverage of the BAC library, twenty-four microsatellites (Lca318, Lca064, Lca137, Lca171, Lca098, Lca062, Lca130, Lca086, Lca301, Lca002, Lca058, Lca074, Lca253, Lca147, Lca069, Lca367, Lca021, Lca193, Lca220, Lca181, Lca255, Lca040, Lca411 and Lca231) located on each of the 24 linkage groups (Table 1) [6], and 15 ESTs/genes isolated from cDNA libraries or selected from GenBank were used to screen the library. These 15 ESTs/genes are: PVALB-1, 5-HT, PROL-A, 14KDA-AP, AMY-A, MX, AP, LECT2, LYSO-G, IGF-1, TUB1A, TUB2B, GT7, CYP19A2 and AFPII. Primers (Table 2) were designed in unique regions for each EST/gene using software PrimerSelect (Dnastar, WI, USA). The PCR reaction (25 μl) consisted of 2 μl cultured cells, 1 × PCR buffer (Finnzymes, Espoo, Finland) containing 1.5 mM MgCl2, 200 nM of each primer, 50 μM of each dNTP and one unit DNA polymerase (Finnzymes, Espoo, Finland). PCR was conducted on a PTC-100 PCR machine (MJ Research, CA, USA) using the following PCR program: an initial denaturation at 95°C for 2 min followed by 35 cycles 95°C for 30 sec, 55°C for 30 sec and 72°C for 1–2 min, and a final extension at 72°C for 5 min. PCR products are checked for the presence of PCR products on 2% agarose gels. Positive pools were used to determine a set of addresses corresponding to potential clones, which were subsequently validated by a third PCR analysis of individual clones. PCR products of respective microsatellites and genes/ESTs were confirmed by direct sequencing.

Microsatellite isolation from BAC clones and linkage mapping

DNA was isolated from pool of 300 BAC clones using a QIAwell 8 Plasmid Kit (Qiagen, HRB, Germany). CA- and GA-microsatellites located in the 300 BAC clones were enriched according to a previous protocol [24] with some modifications [25]. Repeat-enriched DNA fragments of 400–1200 bp in size were cloned into pGEM-T vector (Promega, CA, USA), and transformed into XL-10 blue supercompetent cells (Stratagene, CA, USA). White clones were picked and arrayed into 96-well plates for bidirectional sequencing on an ABI3730 × l DNA sequencer (ABI, CA, USA) using the BigDye V3.0 kit, M13 forward and M13 reverse primers. Redundant and overlapping sequences were grouped using Sequencher (GeneCodes, MI, USA). Unique sequences were compared to known microsatellite sequences of L. calcarifer prior to primer design in order to reduce redundancy. Genotyping and linkage mapping of these microsatellites were performed with the mapping panel described previously [6]. The graphic maps were generated using Mapchart software [26]. To identify the origin of each microsatellite from the 300 BAC clones, these clones were PCR-screened with microsatellite primers. PCR products were checked for the presence of objective bands on 2% agarose gels.

List of abbreviations

BAC: 

bacterial artificial chromosome

QTL: 

quantitative trait loci

LG: 

linkage group

PVALB-1: 

pavalbumin beta gene 1

5-HT: 

5-hydroxytryptamine type 1 receptor

PROL-A: 

prolactin gene alpha type

14KDA-AP: 

14kDa apolipoprotein gene

AMY-A: 

amylayse gene alpha type

AP: 

aminopeptidase gene

LYSO-G: 

lysozyme goose type

TUB1A: 

tublin 1 alpha type

TUB2B: 

tublin 2 beta type

GT7-EST containing a (GT)7 microsatellite: 

CYP19A2-cytochrome P450 aromatase alpha type 2 and AFPII-type II antifreeze protein.

Declarations

Acknowledgements

This study is part of the project "Selective Breeding of Marine Foodfish" funded by AVA, Singapore and the internal research fund from the Temasek Life Sciences Laboratory, Singapore. We would like to thank Dr. Xia J.H. for his comments on the manuscript before submission.

Authors’ Affiliations

(1)
Molecular Population Genetics Group, Temasek Life Sciences Laboratory, National University of Singapore

References

  1. Nelson J: Fishes of the world. Edited by: Sons JW. 1994 , New YorkGoogle Scholar
  2. Berra TM: Freshwater Fish Distribution. . 2001, San Diego , Academic PressGoogle Scholar
  3. Zhu ZY, Lin G, Lo LC, Xu YX, Feng F, Chou R, Yue GH: Genetic analyses of Asian seabass stocks using novel polymorphic microsatellites. Aquaculture. 2006, 256 (1-4): 167-173. 10.1016/j.aquaculture.2006.02.033.View ArticleGoogle Scholar
  4. Andersson L: Genetic dissection of phenotypic diversity in farm animals. Nat Rev Genet. 2001, 2 (2): 130–130-10.1038/35052563.View ArticleGoogle Scholar
  5. Carrey G, Mather P: Karyotypes of four species Melanotaenia duboulayi; Bidyanus bidyanus, Macquaria novemaculeata and Lates calcarfer. Cytobios. 1999, 100 (395): 137-146.Google Scholar
  6. Wang CM, Zhu ZY, Lo LC, Feng F, Lin G, Yang WT, Li J, Yue GH: A microsatellite linkage map of Barramundi, Lates calcarifer. Genetics. 2007, 175 (2): 907-915. 10.1534/genetics.106.059972.PubMedPubMed CentralView ArticleGoogle Scholar
  7. Wang CM, Lo LC, Zhu ZY, Yue GH: A genome scan for quantitative trait loci affecting growth-related traits in an F1 family of Asian seabass (Lates calcarifer). BMC Genomics. 2006, 7: 274-10.1186/1471-2164-7-274.PubMedPubMed CentralView ArticleGoogle Scholar
  8. Tanksley SD, Ganal MW, Martin GB: Chromosome landing: a paradigm for map-based gene cloning in plants with large genomes. Trends Genet. 1995, 11 (2): 63-68. 10.1016/S0168-9525(00)88999-4.PubMedView ArticleGoogle Scholar
  9. Wang GL, Holsten TE, Song WY, Wang HP, Ronald PC: Construction of a rice bacterial artificial chromosome library and identification of clones linked to the Xa-21 disease resistance locus. Plant J. 1995, 7 (3): 525-533. 10.1046/j.1365-313X.1995.7030525.x.PubMedView ArticleGoogle Scholar
  10. Demars J, Riquet J, Feve K, Gautier M, Morisson M, Demeure O, Renard C, Chardon P, Milan D: High resolution physical map of porcine chromosome 7 QTL region and comparative mapping of this region among vertebrate genomes. BMC Genomics. 2006, 7: 13-10.1186/1471-2164-7-13.PubMedPubMed CentralView ArticleGoogle Scholar
  11. Luo MZ, Kim HR, Kudrna D, Sisneros NB, Lee SJ, Mueller C, Collura K, Zuccolo A, Buckingham EB, Grim SM, Yanagiya K, Inoko H, Shiina T, Flajnik MF, Wing RA, Ohta Y: Construction of a nurse shark (Ginglymostoma cirratum) bacterial artificial chromosome (BAC) library and a preliminary genome survey. BMC Genomics. 2006, 7: 294-10.1186/1471-2164-7-106.View ArticleGoogle Scholar
  12. Quiniou SM, Waldbieser GC, Duke MV: A first generation BAC-based physical map of the channel catfish genome. BMC Genomics. 2007, 8: 40-10.1186/1471-2164-8-40.PubMedPubMed CentralView ArticleGoogle Scholar
  13. Budiman MA, Mao L, Wood TC, Wing RA: A deep-coverage tomato BAC library and prospects toward development of an STC framework for genome sequencing. Genome research. 2000, 10 (1): 129-136.PubMedPubMed CentralGoogle Scholar
  14. Buitkamp J, Kollers S, Durstewitz G, Fries R, Welzel K, Schäfer K, Kellermann A, Lehrach H: Construction and characterization of a gridded cattle BAC library. Anim Genet. 2000, 31: 347-351. 10.1046/j.1365-2052.2000.00675.x.PubMedView ArticleGoogle Scholar
  15. Fahrenkrug SC, Rohrer GA, Freking BA, Smith TP, Osoegawa K, Shu CL, Catanese JJ, de Jong PJ: A porcine BAC library with tenfold genome coverage: a resource for physical and genetic map integration. Mamm Genome. 2001, 12: 472-474. 10.1007/s003350020015.PubMedView ArticleGoogle Scholar
  16. Vaiman D, Billault A, Tabel-Aoul K, Schibler L, Vilette D, Oustry-Vaiman A, Soravito C: Construction and characterization of a sheep BAC library of three genome equivalents. Mammalian Genome. 1999, 10: 585-587. 10.1007/s003359901049.PubMedView ArticleGoogle Scholar
  17. Liu W, Zhao YH, Liu ZL, Zhang Y, Lian ZX, Li N: Construction of a 7-fold BAC library and cytogenetic mapping of 10 genes in the giant panda (Ailuropoda melanoleuca). BMC Genomics. 2006, 7: 294-10.1186/1471-2164-7-294.PubMedPubMed CentralView ArticleGoogle Scholar
  18. Thorsen J, Zhu BL, Frengen E, Osoegawa K, de Jong PJ, Koop BF, Davidson WS, Hoyheim B: A highly redundant BAC library of Atlantic salmon (Salmo salar): an important tool for salmon projects. BMC Genomics. 2005, 6: 50-10.1186/1471-2164-6-50.PubMedPubMed CentralView ArticleGoogle Scholar
  19. Katagiri T, Asakawa S, Minagawa S, Shimizu N, Hirono I, Aoki T: Construction and characterization of BAC libraries for three fish species; rainbow trout, carp and tilapia. Anim Genet. 2001, 32: 200-204. 10.1046/j.1365-2052.2001.00764.x.PubMedView ArticleGoogle Scholar
  20. Katagiri T, Kidd C, Tomasino E, Davis JT, Wishon C, Stern JE, Carleton KL, Howe AE, Kocher TD: A BAC-based physical map of the Nile tilapia genome. BMC Genomics. 2005, 6 (1): 89-10.1186/1471-2164-6-89.PubMedPubMed CentralView ArticleGoogle Scholar
  21. Katagiri T, Asakawa S, Hirono I, Aoki T, Shimizu N: Genomic bacterial artificial chromosome library of the Japanese flounder Paralichthys olivaceus. Mar Biotechnol. 2000, 2 (6): 571-576. 10.1007/s101260000041.PubMedView ArticleGoogle Scholar
  22. Peterson DG, Tomkins JP, Frisch DA, Wing RA, Paterson AH: Construction of plant bacterial artificial chromosome (BAC) libraries: An illustrated guide. J Agr Genomics. 2000, 5: [http://www.ncgr.org/research/jag]Google Scholar
  23. Strong SJ, Ohta Y, Litman GW, Amemiya CT: Marked improvement of PAC and BAC cloning is achieved using electroelution of pulsed-field gel-separated partial digests of genomic DNA. Nucleic Acids Res. 1997, 25 (19): 3959-3961. 10.1093/nar/25.19.3959.PubMedPubMed CentralView ArticleGoogle Scholar
  24. Fischer D, Bachmann K: Microsatellite enrichment in organisms with large genomes (Allium cepa L.). Biotechniques. 1998, 24 (5): 796-800, 802.PubMedGoogle Scholar
  25. Yue GH, Chen F, Orban L: Rapid isolation and characterization of microsatellites from the genome of Asian arowana (Scleropages formosus, Osteoglossidae, Pisces). Mol Ecol. 2000, 9 (7): 1007-1009. 10.1046/j.1365-294x.2000.00939-10.x.PubMedView ArticleGoogle Scholar
  26. Voorrips RE: MapChart: software for the graphical presentation of linkage maps and QTLs. J Hered. 2002, 93 (1): 77-78. 10.1093/jhered/93.1.77.PubMedView ArticleGoogle Scholar

Copyright

© Wang et al; licensee BioMed Central Ltd. 2008

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Advertisement