Open Access

Isolation and characterization of microsatellite markers from the olive fly, Bactrocera oleae, and their cross-species amplification in the Tephritidae family

  • Antonios A Augustinos1, 2,
  • Elias E Stratikopoulos1, 4,
  • Eleni Drosopoulou3,
  • Evdoxia G Kakani2,
  • Penelope Mavragani-Tsipidou3,
  • Antigone Zacharopoulou1 and
  • Kostas D Mathiopoulos2Email author
BMC Genomics20089:618

DOI: 10.1186/1471-2164-9-618

Received: 11 October 2008

Accepted: 19 December 2008

Published: 19 December 2008

Abstract

Background

The Tephritidae family of insects includes the most important agricultural pests of fruits and vegetables, belonging mainly to four genera (Bactrocera, Ceratitis, Anastrepha and Rhagoletis). The olive fruit fly, Bactrocera oleae, is the major pest of the olive fruit. Currently, its control is based on chemical insecticides. Environmentally friendlier methods have been attempted in the past (Sterile Insect Technique), albeit with limited success. This was mainly attributed to the lack of knowledge on the insect's behaviour, ecology and genetic structure of natural populations. The development of molecular markers could facilitate the access in the genome and contribute to the solution of the aforementioned problems. We chose to focus on microsatellite markers due to their abundance in the genome, high degree of polymorphism and easiness of isolation.

Results

Fifty-eight microsatellite-containing clones were isolated from the olive fly, Bactrocera oleae, bearing a total of sixty-two discrete microsatellite motifs. Forty-two primer pairs were designed on the unique sequences flanking the microsatellite motif and thirty-one of them amplified a PCR product of the expected size. The level of polymorphism was evaluated against wild and laboratory flies and the majority of the markers (93.5%) proved highly polymorphic. Thirteen of them presented a unique position on the olive fly polytene chromosomes by in situ hybridization, which can serve as anchors to correlate future genetic and cytological maps of the species, as well as entry points to the genome. Cross-species amplification of these markers to eleven Tephritidae species and sequencing of thirty-one of the amplified products revealed a varying degree of conservation that declines outside the Bactrocera genus.

Conclusion

Microsatellite markers are very powerful tools for genetic and population analyses, particularly in species deprived of any other means of genetic analysis. The presented set of microsatellite markers possesses all features that would render them useful in such analyses. This could also prove helpful for species where SIT is a desired outcome, since the development of effective SIT can be aided by detailed knowledge at the genetic and molecular level. Furthermore, their presented efficacy in several other species of the Tephritidae family not only makes them useful for their analysis but also provides tools for phylogenetic comparisons among them.

Background

The Tephritidae family of insects includes the most important agricultural pests of fruits and vegetables. Most of them belong to four genera: Bactrocera, Ceratitis, Anastrepha and Rhagoletis. Ceratitis includes 89 different species. Among them, the Medfly, Ceratitis capitata, is the best so far studied member of the family and attacks over 350 different fruits and vegetables in tropical and sub-tropical regions [1], causing damages of hundreds of billions $ per year. Anastrepha is the most economically important genus of pests in the American tropics and subtropics and includes more than fifteen economically important pests [2]. Rhagoletis includes more than 60 described species distributed in Eurasia and the New World, several of which are important pests [3]. Bactrocera is among the largest genera in Tephritidae including about 500 species [4, 5]. Many of them are serious pests of fruits and vegetables in different parts of the world [2]. The only member of this genus present in Europe is the olive fruit fly, Bactrocera oleae, the major pest of the olive fruit, with estimated damages of 5–30% of the global olive production, resulting in economic losses of about 800 million $ per year [6, 7]. Quarantine orders against non-indigenous Tephritidae exist in all countries, demonstrating the appreciation of these species' destructive abilities and invasiveness success [812].

Currently, control of these insects is based on chemical insecticides. The Sterile Insect Technique (SIT) is the most promising, environmentally friendly method, based on the mass production and release of sterile insects into field populations. When the released males mate with the field females no progeny are produced and the field population may finally be suppressed. The appreciation of the negative effect of the released females [13] lead to the development of genetic sexing strains (GSS) [14]. Successful development of such approaches, however, presupposes an understanding of the species at the genetic, molecular and population level. Additionally, new molecular and genetic tools, such as genetic transformation, could prove very helpful since they can improve mass rearing of effective male insects. Such knowledge developed in the Medfly lead to successful SIT protocols (for a review, see [15]), whereas respective lack in the olive fly lead to fruitless attempts. In the early '70s, efforts to employ the SIT against the olive fly were unsuccessful [16], principally due to the low competitiveness of the sterile mass-reared males compared to the wild ones [17]. Several molecular and genetic studies have changed B. oleae's research landscape in recent years. Among them we mention studies on population genetics [1820], cytogenetics (for a review see [21]), sex-determining cascades [22, 23] and, most notably, the successful genetic transformation [24], an achievement that gives new perspectives towards the efficient use of the SIT.

Microsatellites constitute very powerful genetic and molecular markers [2527]. In the Medfly they have been used to identify sources of origin, invasion phenomena, to design control strategies [2831], as well as in the genetic mapping of the species [32]. This last possibility renders microsatellite markers particularly useful in the olive fly, since several years of efforts have provided no morphological markers and therefore the development of classical genetics has been entirely hindered (Mavragani, unpublished; Zacharopoulou, unpublished). In addition, such markers can also be helpful in SIT development. For example, they have been successfully used in the analysis of mating systems in B. dorsalis [33] and C. capitata [34, 35] and they can be used to detect the degree of differentiation between laboratory and wild flies, the main reason of SIT failure in the olive fly.

The present study enriches a previously described set of 15 microsatellite markers [36, 19] with 16 new ones. Most of these markers were proven polymorphic, some of them were localized in the polytene chromosomes of the species and many of them were successfully cross-amplified in other Tephritidae species. Their utility in genetic studies and evolutionary comparisons is considered.

Results and discussion

Isolation and characterization of microsatellites from small-insert genomic libraries and enriched libraries

Thirty-four microsatellite containing clones were isolated from small-insert genomic libraries and 24 from enriched libraries, yielding a total of 36 and 26 discrete microsatellite motifs, respectively, since a few of them contained more than one microsatellite motif (Table 1). Despite the use of an equal mix of (GT)15 and (CT)15 as probes, there was a clear predominance of GT over CT repeats obtained from the small-insert library. This most likely reflects a difference in the abundance of these sequences in the genome, as has been the case in other Diptera, such as D. melanogaster [3739], D. simulans [40], A. gambiae [41] and C. capitata (Stratikopoulos et al., submitted) [28]. In hymenoptera, CT repeats seem to be more abundant than GT repeats, as studies in Apis mellifera and Bombus terrestris reveal [42].
Table 1

Microsatellite loci motif and in situ localization to polytene chromosomes

 

Accession number

Locus name

Motif

Map position

T (°C)

1

EU489746

Boms1

(GT)13

-

 

2

AF467831

Boms2

(CA)8TA(CA)3

4 (IL)

58

3

EU489747

Boms3

(GT)14

(CAA)3CAG(CAA)3

no specific signal

 

4

EU489748

Boms4

(GT)15GC(GT)3GC(GT)13GA(GT)4

-

 

5

EU489749

Boms5

(CA)10TA(CA)2

95 (VR)

 

6

EU489750

Boms6

(CA)9

(GT)3GG(GT)11TT(GT)2

-

 

7

EU489751

Boms7

(CA)7CC(CA)3

-

 

8

EU489752

Boms8

(CA)7CG(CA)5

-

 

9

EU489753

Boms9

(GT)10CTGA(GT)3

-

 

10

AF467830

Boms10

(CA)10GA(CA)2

no specific signal

55–62

11

AF467832

Boms11 (Bo-D37)

(CA)7CG(CA)3

-

 

12

EU489754

Boms12

(CA)10AACA

26 (IIL)

58

13

EU489755

Boms13

GTGA(GT)10

-

 

14

EU489756

Boms14

(AT)2GT(AT)11

-

 

15

EU489757

Boms15

(GT)11GA(GT)2

no specific signal

55–62

16

AF467829

Boms16 (Bo-D46)

(CA)10

42(IIR)

58

17

EU489758

Boms17

(TG)13

44(IIR)

58

18

AF467828

Boms18

(CA)13

-

 

19

EU489759

Boms19

CAAA(CA)10

-

 

20

EU489760

Boms20

(GT)13+

8(IL) 2 signals

58

21

AF467827

Boms21

GTGG(GT)13ATGT

73(IVL)

58

22

DQ078248

Boms22

CAT(CA)7(TA)3TT(TA)5

5(IL)

58

23

EU489761

Boms23

(CA)12

3(IL)

58

24

EU489762

Boms24

(GT)12

64(IIIR)

58

25

AF467826

Boms25

(GT)12

30(IIL), 97&100(VR)

58/62

26

EU489763

Boms26

(GT)8AT(GT)2

26(IIL)

58

27

AF467825

Boms27 (Bo-D52)

(GA)14

83(IVR)

58

28

EU489764

Boms28

(CA)12CT(CA)5 (GA)12GG(GA)11

-

 

29

AF467824

Boms29

(GT)10

-

 

30

AF467823

Boms30

(GT)17

5–6(IL)

58

31

DQ078249

Boms31

(GT)4GC(GT)6GC(GT)2

63&65(IIIR)

58,62

32

EU489765

Boms32

(CA)14

-

 

33

EU489766

Boms33

(CA)2TA(CA)9

no signal

55–58

34

EU489767

Boms34

(CA)3CTA(CA)8

86(IVR)

58

35

EU489768

Boms35

(CA)48

-

 

36

EU489769

Boms36

(CA)24

-

 

37

EU489770

Boms37

(TG)4G(TG)3

-

 

38

EU489771

Boms38

(GT)10AT(GT)6

-

 

39

EU489772

Boms41

GTAT(GT)8GCGTGA(GT)4

-

 

40

EU489773

Boms42

(AT)3CC(GT)3(AT)3(GT)14GAGT

-

 

41

EU489774

Boms43

(CA)18C(CA)3

-

 

42

EU489775

Boms45

TAA(CAA)6

-

 

43

EU489776

Boms47

(AG)12TG(AG)8(TG)3(AG)10

-

 

44

EU489777

Boms48

(TC)5C8G(CT)4C5G(CT)5C5G(CT)6CCTCG(CT)8

-

 

45

EU489778

Boms49

(CA)3CT(CA)3CT(CA)3CT(CA)9

-

 

46

EU489779

Boms50

(GA)18N4(GA)2G4(GA)2G4(GA)14CA(GA)2TA(GA)5

-

 

47

EU489780

Boms53

T8GT10GT7CGT9GT6

-

 

48

EU489781

Boms55

(AG)13GG(AG)3GC(AG)8

-

 

49

EU489782

Boms58

A6CA3GCA6TA5CA5

-

 

50

DQ078250

Boms59

TGTA(TG)10

-

 

51

DQ078251

Boms60

(CAAA)2

A6CA3GCA6TA5CA4N26A2GA9CGA4

-

 

52

DQ078252

Boms61

T23G2T3GT3GT2GTAAT4C2T5CTGT5

-

 

53

EU489783

Boms62

A11CA11CATCACA4GA2GA8

-

 

54

EU489784

Boms63

A3CA3CCA18

-

 

55

EU489785

Boms64

CAGA(CA)2C(CA)4N12(CA)4C(CA)2

(CA)5C(CA)4C(CA)4ACACC(CA)3C(CA)3

-

 

56

EU489786

Boms68

T8

-

 

57

EU489787

Boms69

(A/G TT)4N4T7(CTT)2AGT4CA2T4GT4

-

 

58

EU489788

Boms70

(GT)-rich

-

 

Boms1–34: Microsatellite loci isolated from total, small-insert DNA libraries

Boms35–70: Microsatellite loci isolated from enriched libraries

T: annealing temperature for in situ hybridization

(-): not tested

N: bases that do not present any motif

A significant predominance of interrupted (60.5%) over perfect motifs (34.2%) was observed in both isolation approaches, while only a few (5.2%) were compound. These percentages are quite similar to those observed in C. capitata [28] and B. terrestris [42]. On the other hand, they are not in agreement with results from B. tryoni [43], B. morii [44], D. pseudoobscura [45] and a recent study in C. capitata (Stratikopoulos et al., submitted). Therefore, it is unclear whether these results represent the actual structure of microsatellites in the olive fly genome, since data from closely related species are conflicting. Possibly these results can be attributed to differences in isolation strategies.

In situ hybridization to polytene chromosomes

Cytological analysis of B. oleae has revealed five chromosomes (10 polytene arms) and a heterochromatic mass, corresponding to the five autosomes and the sex chromosomes, respectively (for a review see [21]). Well-defined polytene maps have been produced, providing the opportunity for a cytologic localization of molecular markers on the chromosomes.

Twenty of the isolated microsatellite clones were in situ hybridised to the salivary gland polytene chromosomes of B. oleae, in order to identify their chromosomal localization. At hybridisation temperature of 58°C, sixteen of the microsatellite probes gave specific signals (Table 1) and 13 of them mapped to unique chromosome loci. Clone Boms20 hybridised to two neighbouring bands of the same chromosome region, Boms31 hybridised to two regions on the same chromosome arm, while Boms25 mapped to three regions on two chromosome arms (Table 1, Fig. 1) [Note that microsatellite loci and clones' names are written in italics whereas microsatellite markers' names are written in regular font]. These microsatellite clones gave the same multiple hybridisation pattern even at the higher hybridisation temperature of 62°C. Chromosome localization was not possible for four of the microsatellite probes, although tested at several hybridisation temperatures. Lack of hybridization signal can be attributed either to insufficient hybridization due to small probe length or to the fact that these clones may lie in heterochromatic regions (such as sex chromosomes or centromeric regions). Boms33 gave no detectable signal, while the remaining three gave multiple signals.
https://static-content.springer.com/image/art%3A10.1186%2F1471-2164-9-618/MediaObjects/12864_2008_Article_1811_Fig1_HTML.jpg
Figure 1

Schematic representation of the in situ localization of microsatellite markers on the polytene chromosomes of Bactrocera oleae. Arrows that originate from numbers in bold stand for the Boms microsatellite markers. Underlined numbers refer to microsatellite markers that give multiple signals. All other arrows refer to previously mapped loci [Zambetaki et al 1999].

The thirteen microsatellites that uniquely mapped to the polytene chromosomes of B. oleae are dispersed on seven polytene arms, establishing genetic markers for all five autosomes. Table 1 summarizes the microsatellite hybridization sites and Figure 1 schematically presents the relative positions of the hybridization signals to the polytene chromosome arms of B. oleae together with previously described markers [21]. Hybridization signals are presented in Figure 2.
https://static-content.springer.com/image/art%3A10.1186%2F1471-2164-9-618/MediaObjects/12864_2008_Article_1811_Fig2_HTML.jpg
Figure 2

In situ hybridization of several microsatellite probes on the salivary gland polytene chromosomes of Bactrocera oleae. a: Boms23; b: Boms2; c: Boms17; d: Boms31; e: Boms24; f: Boms34. Arrows indicate the hybridization signals.

Although their number is small, they enrich the already existing cytological map and are the basis for a low-resolution cytogenetic map that will facilitate future genome projects of the species. It is encouraging that these thirteen markers are dispersed in seven of the ten chromosome arms (except IR, IIIL, VL). However, our in situ hybridization data are still limited to support a claim of a uniform distribution of microsatellite loci in the olive fly genome.

Development of microsatellite markers

Unique sequences flanking each repeat array were used to design PCR primer pairs for the amplification of 42 microsatellites. Thirty-one primer pairs amplified a product of the expected size, as revealed by agarose gel electrophoresis (Table 2). Subsequently, all primer pairs that amplified a specific band were used for the genotyping of 20 individual wild flies (from Greece and Cyprus) and/or up to 37 individuals of a laboratory strain. In addition, 19 C. capitata microsatellite markers (Stratikopoulos et al., submitted) that cross-amplified in the olive fly were used, raising the total number of functional primer pairs to 50 (Table 2). In total, 37 primer pairs (29 designed for the olive fly and eight for the medfly) amplified a polymorphic and easily scorable PCR product, while eight pairs amplified a monomorphic one. The five remaining primer pairs generated PCR products that were not easily scored (shuttered or multiple bands or faint signal).
Table 2

Microsatellite markers' characteristics and genetic variability

Marker

Primer pairs

E.S

Tm

Samples

N

na

ne

Ho

He

HWEG2

Boms2

F: GCTGTTTTGAATGTCAGCATC

R: TGTATGCGTGACTGTTTACG

128

50

wild

laboratory

20

13

3

3

1.75

2.15

0.45

0.54

0.44

0.56

-

-

Boms3a

F: CAGTCGCCCTTTAATTTGC

R: GGGTCCTTTTGTTCTCAGG

176

50

laboratory

32

4

2.39

0.63

0.59

-

Boms3b

F: AGGACCCTGGCACAATTCG

R: TATGGCATGGCAAGCAGC

171

50

laboratory

32

4

2.26

0.59

0.57

-

Boms5

F: TCTCGCCCCAATTACCAC

R: GAATTTTGGCAACATCCAAGC

105

50

laboratory

34

4

3.25

0.79

0.70

-

Boms6a

F: TCACTAAAAGGAGTCCGCAC

R: GAGCAGGTCAGAGGCAAAAG

173

50

laboratory

35

3

1.64

0.43

0.39

-

Boms6b

F: AAACCTTACCCTTTTGCCTC

R: AGTGCCAACTGAATGCTG

118

50

laboratory

35

3

2.10

0.49

0.53

-

Boms8

F: TGACATACATGCCTTCATTCAC

R: CAGAAAAGCTTAAAACTAGCGG

75

50

wild

laboratory

20

9

6

3

3.10

2.66

0.85

0.56

0.69

0.66

-

-

Boms10

F: CAGAGCATCTCGCTTTGG

R: TCAACAATCCCAGCAAAATC

172

50

wild

laboratory

20

33

5

2

3.33

1.27

0.70

0.12

0.72

0.22

-

+

Boms11

F: ATAGGCATTGGCAGCGAAG

R: CACAGTGGGCCGAAATCAC

185

50

wild

laboratory

20

25

4

2

1.88

1.68

0.50

0.32

0.48

0.41

-

-

Boms12

F: CGCGTTTTCATACTTTAACACC

R: TTCATTTGGCCTTTGTGC

158

50

wild

19

3

1.17

0.16

0.15

-

Boms14

F: TTTGTAATTCGCAGAAGGCAC

R: AGGAGGACTGACAGAAGGACAC

147

50

wild

8

4

2.72

0.38

0.68

 

Boms16

F: CAGACAATGGATGGATACATGC

R: GGAGAAGTCAAATTGTGACAGC

109

50

wild

20

5

1.72

0.50

0.43

-

Boms17

F: ATTAGACCATAGTGTTCTCAC

R: AAGATGTTGAGTGCCGTTG

170

50

wild

laboratory

20

31

7

5

5.76

1.41

0.35

0.19

0.85

0.29

+

-

Boms18

F: GCCATGAATGCAGACCAC

R: CCTATTCAAATGCACGCAAAAC

171

50

wild

laboratory

20

33

6

3

2.56

1.94

0.80

0.39

0.63

0.49

-

+

Boms21

F: TCGCCTCTTACCTCACAACC

R: ACCATCCTTAGTCAGCACAGTC

188

50

wild

laboratory

20

28

6

4

3.77

1.16

0.75

0.14

0.75

0.14

-

-

Boms22

F: GTAAAGCACACGGAAGCG

R: TGAGGTCAAAAAGGATGCTAAG

211

50

wild

laboratory

18

7

2

2

1.06

1.32

0.06

0.29

0.06

0.26

-

-

Boms24

F: ATTTCGCTTGCCACAAAC

R: CGCCCAAGCACTTAAAAC

215

50

laboratory

33

2

1.77

0.39

0.44

-

Boms25

F: TGGAATGCGCTATTTTGTTG

R: ACTCGTATATACGTACATGG

167

50

wild

laboratory

20 33

5

3

3.49

2.16

0.80

0.55

0.73

0.55

-

-

Boms27

F: CGACTTGAAGGACAATTGG

R: GGCGTGAGTAGTTTCTATAAGC

129

50

wild

laboratory

20

10

5

3

2.02

2.41

0.55

0.50

0.52

0.62

-

-

Boms29

TGAAGGTGATGAATGAAAGC

GGAATGACTGTGAGCAAGC

118

50

wild

laboratory

20

13

5

1

2.57

1.00

0.60

0.00

0.63

0.00

-

Boms30

F: CTGACTTCTTGCTTTACACG

R: CAGCTTATCTGCTTTAAGTGC

150

50

wild

laboratory

20

9

4

4

2.12

2.19

0.70

0.78

0.54

0.58

-

Boms31

F: TGCTTGAGTTGCTCGTTGG

R: GCCGCATGACATAAAGAATCG

173

50

wild

laboratory

20

30

4

2

3.27

1.03

0.75

0.03

0.71

0.03

-

Boms32

F: TGTATGTATTTGTGCGTCG

R: GCTTAGACCATTTGCTCC

125

50

wild

20

7

3.96

0.55

0.77

-

Boms34

F: ACGCCGCACACTTCTTAAAC

R: CACCCAACTTTTGTAGTTTCC

219

50

laboratory

34

3

2.08

0.65

0.53

-

Boms47

F: CAAACACACGCTAAAACG

R: TTTAACCCAGAGGCTTGC

158

50

wild

18

6

3.15

0.61

0.70

-

Boms58

F: AGTTGGACGCGCACATATC

R: AGCGCGTACGAGCTTTAGC

181

50

wild

laboratory

18

30

7

3

5.02

1.15

0.72

0.13

0.82

0.13

-

-

Boms59

F: AGCGCTTACATAAATATAGCTAC

R: TCCCCGTAAAGCCATAAAGTC

171

50

wild

20

5

2.27

0.50

0.57

-

Boms60

F: TGGACGCGCACATATCAG

R: ACGACGTTTAGCGGAAATGAG

170

50

wild

laboratory

20

37

6

3

3.14

1.21

0.70

0.19

0.70

0.18

-

-

Boms62

F: CTTTCGCTGCCTCCATTTG

R: CAAAACCCCTCTGCAATCC

174

50

wild

20

2

2.00

0.55

0.51

-

Boms64a

F: TGCTAGGCTGAACATTCG

R: TGTTTTGCTGTTTCCAGG

129

50

wild

20

Multiple bands

 

Boms64b

F: TGGAAACAGCAAAACACC

R: AGCGAATCAAGAGACAGC

137

50

wild

10

Multiple bands

 

Medflymic9

Stratikopoulos et al., submitted

50

wild

8

3

2.42

0.88

0.63

 

Medflymic142

>>

50

wild

9

monomorphic

 

Medflymic149

>>

50

wild

8

monomorphic

 

Medflymic150

>>

50

wild

8

3

2.03

0.50

0.54

 

Medflymic151

>>

50

wild

20

5

2.66

0.35

0.64

+

Medflymic152

>>

50

wild

20

6

5.00

0.40

0.82

+

Medflymic153

>>

50

wild

20

3

2.24

0.40

0.57

-

Medflymic154

>>

50

wild

10

monomorphic

 

Medflymic157

>>

50

wild

10

monomorphic

 

Medflymic158

>>

50

wild

8

3

2.25

0.63

0.59

 

Medflymic163

>>

50

wild

10

monomorphic

 

Medflymic22

>>

55

wild

20

Multiple bands

 

Medflymic23

>>

55

wild

20

monomorphic

 

Medflymic29

>>

55

wild

20

Multiple bands

 

Medflymic40

>>

55

wild

20

Multiple bands

 

Medflymic61

>>

55

wild

20

4

2.32

0.45

0.58

-

Medflymic64

>>

55

wild

20

monomorphic

 

Medflymic72

>>

55

wild

20

monomorphic

 

Medflymic109

>>

55

wild

20

2

1.05

0.05

0.05

-

 

Mean wild (monomorphic excluded)

Mean laboratory (monomorphic excluded)

 

19.5

26.5

4.63

3.14

2.74

1.90

0.53

0.44

0.57

0.44

 

E.S: Expected size

Tm: PCR annealing temperature

N: sample size

na: actual number of alleles; ne: effective number of alleles

Ho: heterozygosity observed; He: heterozygosity expected

(-): in HWE; (+): out of HWE

The mean allele number per locus was 4.63 for natural populations and 3.14 for laboratory strains (monomorphic loci excluded), demonstrating their usefulness in population analyses of the species. Conformation to HWE was tested for 26 loci for natural populations and 19 loci for laboratory strains, according to G2 criterion, at a significance level of 5%. Only five deviations were observed due to homozygosity excess, which can be attributed to small sample size or to the presence of null alleles (Table 2).

Cross – species amplification in Tephritidae

The 29 primer pairs designed for the olive fly and proved polymorphic were tested in a pooled mix of five flies from each one of 11 Tephritidae species. Twenty-six of them amplified a specific DNA fragment, at least in one of the species examined. Four species belong to Bactrocera (B. correcta, B. cucurbitae, B. dorsalis and B. tryoni), four to Anastrepha (A. fraterculus, A. ludens, A. serpetina and A. striata), two to Ceratitis (C. capitata and C. fasciventris) and one belongs to Rhagoletis (R. cerasi) (Tables 3 and 4).
Table 3

Cross-species amplification of Bactrocera oleae microsatellite markers in other Tephritidae species

Species

Bactrocera

Anastrepha

Ceratitis

Rhagoletis

Markers

Bo

Bcu

Bco

Bd

Bt

Af

Al

Astr

Aser

Cc

Cf

Rc

Boms2

150

400

400

  

Sm

450/

Sm

Sm

Sm

200

200f

Sm

Boms3a

210

210

210

210

230

    

190

190

500

Boms3b

200

X

220

200

210

Sm

Sm

Sm

X

150

 

200

Boms5

110

500

 

700

130

   

300

   

Boms6a

150/

400

350/

Sm

 

350

300/

500

  

Sm

Sm

 

600

200/

300

Boms6b

150

         

150f/

200

 

Boms8

75

         

200

 

Boms10

200

  

180

200

 

180/

Sm

 

120f/

150f

150

200/

300

300

Boms11

200

Sm

220

Sm

Sm

Sm

Sm

Sm

Sm

Sm

Sm

500

Boms12

200

      

Sm

Sm

   

Boms14

150

 

150

 

150

300

 

Sm

Sm

   

Boms16

100

  

100

100

       

Boms18

171

 

170

170

190

Mb

Mb

Mb

Mb

300

300

 

Boms21

188

190

180

 

180

       

Boms22

210

   

500f

       

Boms24

200

 

250

250

250

       

Boms27

130

 

130

130

130

Sm

Sm

Sm

Sm

Sm

150/

Mb

Sm

Boms29

120

           

Boms30

150

150

150

150

150

 

Mb

130

130

110

110

110

Boms31

170

 

120

170

170

500

120f/

300/

500/

600

120f

120f/

400/

500/

700

 

800

450f

Boms32

150

150

          

Boms34

200

 

200

X

200

       

Boms58

180

 

400

150f/

180f

150f/

180f

400

400/

500

500

400

Sm

Sm

Sm

Boms60

170

150f

170

170

170

150

150

150

150

170

250/

Mb

150

Boms62

174

200

160

200

180

160/

Mb

160/

Mb

160/

Mb

160/

Mb

200

160

 

Boms64a

150

      

300/

450

500

   

Numbers in columns indicate PCR product size, as revealed by agarose gel electrophoresis

Sm: smear; f: faint band; Mb: multiple bands

Bo: B. oleae; Bco: B. correcta; Bcu: B. cucurbitae; Bd: B. dorsalis; Bt: B. tryoni; Cc: C. capitata; Cf: C. fasciventris; Af: A. fraterculus; Al: A. ludens; Aser: A. serpentina; Astr: A. striata; Rc: R. cerasi

Table 4

Conservation of Bactrocera oleae microsatellite markers in Tephritidae

Species/

Genera

Functional primer pairs

Expected size

Presence of SSR motif

Presence of the expected motif

Mean number of uninterrupted repeats

B. oleae

29

29

29

29

100%

B. correcta

15/29 (51.7%)

13/15 (86.7%)

13/29 (44.8%)

6/7 (85.7%)

5/6 (83.3%)

5/7 (71.5%)

20/50 (40%)

B. cucurbitae

9/29 (31%)

6/9 (66.7%)

6/29 (20.7%)

2/2 (100%)

2/2 (100%)

2/2 (100%)

11/27 (40%)

B. dorsalis

14/29 (48.3%)

12/14 (85.7%)

12/29 (41.4%)

4/4 (100%)

4/4 (100%)

4/4 (100%)

29/36 (80.5%)

B. tryoni

19/29 (65.5%)

17/19 (89.5%)

17/29 (58.6%)

5/6 (83.3%)

5/5 (100%)

5/6 (83.3%)

32/53 (60%)

Bactrocera

genus

57/116 (49.1%)

48/57 (84.2%)

48/116 (41.4%)

17/19 (89.5%)

16/17 (94.1%)

16/19 (84.2%)

92/166 (55.4%)

A. fraterculus

5/29 (17.2%)

2/5 (40%)

2/29 (6.9%)

2/2 (100%)

1/2 (50%)

1/2 (50%)

8/9 (88.9%)

A. ludens

7/29 (24.1%)

5/7 (71.5%)

5/29 (17.2%)

1/1 (100%)

1/1 (100%)

1/1 (100%)

11/9 (122%)

A. serpentina

9/29 (31%)

6/9 (66.7%)

6/29(20.7%)

1/1 (100%)

1/1 (100%)

1/1 (100%)

8/9 (88.9%)

A. striata

7/29 (24.1%)

5/7 (71.5%)

5/29 (17.2%)

1/1 (100%)

1/1 (100%)

1/1 (100%)

12/9 (133%)

Anastrepha genus

28/116 (24.1%)

18/28 (64.3%)

18/116 (15.5%)

5/5 (100%)

4/5 (80%)

4/5 (80%)

39/36 (108.3%)

C. capitata

8/29 (27.6%)

7/8 (87.5%)

7/29 (24.1%)

1/2 (50%)

1/1 (100%)

1/2 (50%)

2/3 (66.7%)

C. fasciventris

12/29 (41.4%)

9/12 (75%)

9/29 (31%)

2/2 (100%)

2/2 (100%)

2/2 (100%)

12/24 (50%)

Ceratitis genus

20/58 (34.5%)

16/20 (80%)

16/58 (27.6%)

3/4 (75%)

3/3 (100%)

3/4 (75%)

15/27 (55.5%)

R. cerasi

8/29 (27.6%)

4/8 (50%)

13.8%

1/3 (33.3%)

1/1 (100%)

1/3 (33.3%)

2/3 (66.7%)

Functional primer pairs: number of primer pairs that cross-amplified successfully; Expected size: number of primer pairs that cross-amplified and produced fragment of the expected size (calculated either in regard to total available primer pairs or in regard to primer pairs that successfully cross-amplified); Presence of SSR motif: number of cross-species amplification products that harboured a microsatellite motif; Presence of the expected motif: number of cross-species amplification products that harboured the expected microsatellite motif (calculated either in regard to total sequencing reactions or in regard to cross-species amplification products that harboured a microsatellite motif); Mean number of uninterrupted repeats: sum and comparison of the number of uninterrupted repeats for primer pairs that cross-amplified and harboured the expected motif. Dividend represents repeats in the new species, while divider stands for number of repeats in B. oleae

A total of 113 PCR products were amplified. The species with the highest degree of amplification was B. tryoni (19/29), while with the lowest was Rhagoletis cerasi (8/29). As expected, the highest percentage of amplification was inside Bactrocera, with a mean of 49.1%. Ceratitis presented the next higher amplification degree (34.5%), followed by Rhagoletis and Anastrepha (27.6% and 24.1%, respectively) (Table 4 and Figure 3-1). It is worth mentioning that B. cucurbitae exhibited very low amplification rate, similar to that of Anastrepha. Finally, C. capitata presented substantially lower degree of amplification than C. fasciventris.
https://static-content.springer.com/image/art%3A10.1186%2F1471-2164-9-618/MediaObjects/12864_2008_Article_1811_Fig3_HTML.jpg
Figure 3

Cross-species amplification of Bactrocera oleae microsatellites in four Tephritidae genera. 1: Percentage of cross-amplified primer pairs. 2: Percentage of primer pairs that produced a fragment of the expected size.

The majority of PCR products had similar size (less than ~50 bp difference, as estimated by agarose gel electrophoresis) with those obtained in B. oleae (about 76%). Still, the highest degree of PCR product size conservation was inside Bactrocera (84.2%), although Ceratitis showed a comparable percentage (80%). Anastrepha and Rhagoletis presented significantly lower values (64.3% and 50%, respectively) (Table 4 and Figure 3-2). Surprisingly, B. cucurbitae showed very low size conservation (66.7%), comparable to that of Anastrepha, implying that the low amplification value mentioned before may not be a PCR artefact. This in not the case in C. capitata, since size conservation is very high (87.5%). This value is higher than that of C. fasciventris and comparable to that of Bactrocera, suggesting that medfly's low amplification value is more likely a PCR artefact.

Analysis of cross-species amplification products

Amplification of a band of expected size does not necessarily mean that the expected microsatellite motif is also present. To evaluate the degree of motif conservation, 31 of the reactions that produced a specific band were subcloned and sequenced. We focused on PCR products of similar to the expected size and distributed in as many species as possible. Twenty-seven of the amplification products harboured a repeat motif, 25 of which contained the same as that of B. oleae. Six of the products harboured new motifs (instead of or in addition to the expected ones) (Table 5).
Table 5

Microsatellite loci obtained through cross-species amplification

Locus

B. oleae motif

Motif of other Tephritidae

Boms3a

(GT)14

Bt: (AT)G2(AT)3AC(AT)A2(AT)(GT)2(AT)/(TG)2(TA)2(TG)8

Bco: (TG)2TA(GT)N7(TG)2(TA)/(TG)(GA)(TG)2(TA)2(TG)(TA)3(TA3)2(TG)3C(GT)3

Bcu: (TA)3A(TA)CA2(GT)4

Bd: (TA)2TG(TA)CA(TA)3A2(TG)5CA(TG)(TC)2(TA)2(TG)7

Cf:(TG)4T2(TG)8

Boms3b

(CAA)3CAG(CAA)3/

(CAA)2CAG(CAA)

Bco: (CAA)2AAA(CAA)/(CAA)3

Bd: (CAA)2AA(CAA)/(CAA)5

Bt : (CAA)2A(CAA)/(CAA)3

Cc:/(CAA) A3(CAA)2

Rc: A4CA2CGATACA5N9A5/(CAA) G(CAA)2(CAG)

Boms10

(CA)10GA(CA)2

Cc: -

Cf: (CA) GAC(CA)4

Rc: -

Boms11

(CA)7CG(CA)3

Bco: -

Rc: -

Boms14

(AT)2GT(AT)11

Bco:(TA)2G(TA) CA(TA)3A2

Af: G6N7(GT)3

Boms16

(CA)10

Bco: T5ATCA4/A5TCA2A2

Bd: (CA) TG(CA)4

Bt: (CA) TA(CA)4CG(CA)

Boms21

(GT)GG(GT)13AT(GT)

Bco: (GA)3(GT)6

Bcu: (AT)3(GT)(AT)(GT)7

Bt: (GA)3(GT)3AT(GT)5AT(GT)

Boms60

CACA2(CA3)2

A6CA3GCA6TA5CA4N26A2GA9CGA4

Bco: CACA2(CA3)2/A5C2A3(GT)2A4G2A5N7A5N5A3CA3CA2CA3N4A3N3A2N3A5GA2CGA4

Bd: CACA2(CA3)2/A13CA6TA4N4A3CA2TA2CA5

Bt: CACA2(CA3)2/A6CA3GCA6TA5CA5N28A2GA9CGA4

Af: CACA2(CA3)3/(GA)4A3GA8GA4N9GA3GATA4TA8GACA5CA4

Al: CACA2(CA3)3/(GA)4A3GA9GA4N9CA3GATA4TA11CA5CA5

Aser: CACA2(CA3)3/CA5GA5GA4TACA4TACA2TCA2CA3 GATA4TA4TACA5CA8

Astr: CACA2(CA3)3/(GA)4A3GA6C2A3 TACA2TCA2CA3 GATA4TA9CA12

Boms64a

CAGA(CA)2C(CA)4N12(CA)4C(CA)2

Bt: (CA)2A(CA)2C(CA)T2(CA)2

In bold: cases of preservation of the expected motif

N: non-motif bases

Bco: B. correcta; Bcu: B. cucurbitae; Bd: B. dorsalis; Bt: B. tryoni; Cc: C. capitata; Cf: C. fasciventris; Af: A. fraterculus; Al: A. ludens; Aser: A. serpentina; Astr: A. striata; Rc: R. cerasi

Nineteen (of the 31) sequencing reactions were performed in Bactrocera. The presence of a microsatellite motif in 18 of them (16 of which had the expected motif), demonstrates their potential in the analysis of other Bactrocera species. Results from other genera are encouraging, although preliminary. In Ceratitis, for example, four sequencing reactions were performed, three of which exhibited the expected motif. In Anastrepha, five sequencing reactions were performed, all of which exhibited a microsatellite motif with four cases possessing the expected one (however, they all refer to the same locus in four different species). Finally, in Rhagoletis, three sequencing reactions were performed, one of which exhibited a microsatellite repeat of the expected motif. These results are summarized in Tables 4 and 5 and demonstrate the potential utility of these markers in the analysis of Tephritidae genera other than Bactrocera.

Mean number of uninterrupted repeats was measured only in cases where the expected motif was present in cross-species amplification products (Table 4). In seventeen cases within Bactrocera (regarding seven microsatellite loci), the mean number of uninterrupted repeats was 9.8 for B. oleae and 5.4 for the other Bactrocera species. Same analysis for three PCR products (regarding three microsatellites) in Ceratitis gave a mean of 9.0 and 5.0 uninterrupted repeats for B. oleae and Ceratitis, respectively. Although sequencing data are still limited, it is obvious that microsatellites tend to present longer arrays in the species in which they were isolated from. This has been described in a variety of species, such as Drosophila [40, 46] and primates [47], and has been attributed to the fact that microsatellites can evolve directionally and at different rates in closely related species.

Sequencing analysis and phylogenetic comparisons

Although we did not perform a phylogenetic analysis, it seems that measures of cross-species amplification (e.g., percentages of functional primers and expected size of PCR products) are indicative of the phylogenetic history of these species. Our results support the notion that three of the Bactrocera species are very close to B. oleae, while the fourth (B. cucurbitae) seems to be more distant (Table 4, Figure 3). Also, Ceratitis seems to be more closely related to Bactrocera than Anastrepha and Rhagoletis seems to be the most distantly related genus to Bactrocera. These results perfectly replicate the exact same relationships observed in the most recent phylogenetic analysis of these species based on mtDNA sequencing data [48]. Secondarily, they are also supported by several other studies from different insect species based on alignment of mitochondrial 16S rDNA sequences [49, 50] and 18S rDNA sequences [51], which show that Bactrocera is more closely related to Ceratitis, and closer to Anastrepha than it is to Rhagoletis. In addition, we also performed sequencing alignments of a few cross-species amplification products of some of our markers (data not shown). In all cases, the different species were clustered to their respective genera with high bootstrap values. Although these data are very limited, they come from dispersed regions of nuclear DNA which gives significant value to phylogenetic analyses. There are studies supporting that microsatellite data can shed light to phylogenetic relationships among closely related taxa [5254]. Sequencing analysis of more microsatellite markers can probably reveal complex phylogenetic relationships among different Tephritidae species, especially in cases of species complexes.

Polymorphism of cross-species microsatellite markers

Presence of a microsatellite motif does not necessarily mean that these loci can be used as genetic markers. Nineteen microsatellite markers developed in the medfly cross-amplified in the olive fly (Table 2). The fact that eight of them were polymorphic in a relative small sample (twenty wild flies) confirms the possible utility of the markers presented here in the analysis of other Tephritidae species.

Conclusion

Since their discovery, microsatellite markers have been particularly useful in population and genetic analyses, mainly due to their high degree of polymorphism. Their significance is even greater in organisms like the olive fly, where the lack of morphological markers makes classical genetic analysis practically impossible. The interest in olive fly's genetics is not only theoretical, since modern genetic and molecular tools have benefited several operational SIT programmes, particularly those where GSSs are involved [15]. The observed polymorphism of the developed microsatellite markers (both in laboratory and natural populations) guarantees their utility in genetic and population analyses. A subset of these markers has already been successfully used in previous population studies [36, 19]. The existence of well-described polytene chromosomes in the olive fly [21] and the possibility of cytological localization of molecular markers by in situ hybridisation provide a powerful method to link the genetic and molecular information of an organism. The existence of defined polytene chromosomes in other Diptera [55, 56] also offers the opportunity to establish syntenic linkages and to study the evolutionary relationships of separate chromosomal segments [57, 21]. Cross-species amplification of the developed markers to other Tephritidae demonstrates their potential utility in those species. Sequencing analysis of several cross-amplified products revealed a varying degree of conservation that declines outside the Bactrocera genus. Such sequencing analyses can also assist the clarification of phylogenetic relationships among different species, particularly in cases of species complexes.

Methods

Fly culture and stocks

Field-collected samples: Olive fruits were collected and kept in the laboratory until adult flies emerged. These flies were preserved individually at -20°C until DNA extraction.

Laboratory strain

B. oleae flies used for in situ hybridisation and polymorphism analysis were obtained from the Department of Biology, "Demokritos" Nuclear Research Center, Athens, Greece. In our laboratory the stock was reared on an artificial medium based on yeast hydrolysate, sucrose, egg yolk and water [5860] at 25 ± 1°C and a 12 h light: 12 h dark cycle.

Construction and screening of total small insert genomic libraries

Genomic DNA was extracted from adult flies of the laboratory strain as described in [61]. Approximately 3 μg of genomic DNA were digested to completion with Mbo I and digestion products were electrophoresed in 1% agarose gel (Seakem GTG). Restriction fragments that ranged between 500 bp and 1200 bp were isolated from the gel (Jetquick gel extraction kit, Genomed) and cloned into the BamHI site of plasmid vector pBlueskript II SK (Stratagene). About 104 recombinant clones were transferred onto nylon membranes (Hybond-N, Amersham), screened with a mix of radioactively labeled (CT)15 and (GT)15 oligonucleotides. Labelling was performed with terminal transferase (Promega), under the conditions suggested by the manufacturer. Hybridisation was performed at 48°C in standard hybridisation solution (6× SSC, 0.5% SDS, 5× Denhardt's) for at least 16 hours. Membranes were then washed twice for 5 min in 2× SSC/0.1% SDS at 25°C and once for 15 min in 1× SSC/0.1% SDS at 37°C and subsequently exposed with film. Positive colonies underwent a secondary screening and plasmid DNA was then purified by the alkaline lysis method [62] and electrophoresed. Clones of convenient size inserts (i.e., 500–1000 bp) were sequenced (Thermo Sequenase core Sequencing kit, Amersham). Sequencing reactions were analysed in an automatic sequenator and the microsatellite repeat motif was determined.

Construction of microsatellite-enriched genomic libraries

Genomic DNA was extracted as above. Enriched libraries were prepared according to [63]. Seven libraries were constructed using different oligonucleotide probes [(GA)15, (CA)15, (GT)15, (CT)15, (AT)15, (GC)15 and (GAC)10]. Two rounds of enrichment were performed for each library. Enriched products were cloned either in plasmid vector pBlueskript SKII digested with EcoRI, (without removal of the amplification linkers), or into the BamHI site of the pUC18 vector (Ready-To-Go™ pUC18/BamHI, Amersham), (after linker removal). Insert size of recombinant clones was estimated on agarose gels and selected clones were sequenced as above. Selection was done either at random, or after Southern transfer and hybridization with (GT)15 and (CT)15 radiolabelled probes.

In situ hybridization procedures

Squash preparations of salivary gland chromosomes were made from 10–12 day-old third instar larvae and 1–2 day old pupae, as previously described [64]. Microsatellite containing clones were labelled with digoxigenated dUTP (Dig-11dUTP) using the random priming method and in situ hybridized to polytene chromosomes according to [64]. Hybridization temperature was 55–62°C (Table 1). Signals were detected with specific antibodies (ROCHE Diagnostics, Mannheim, Germany). Five or more chromosomal preparations were hybridized with each probe and at least ten well-spread polytene nuclei per preparation were examined to identify the hybridization signals.

Genotyping

PCR amplification was performed in a 10 μl volume that contained ~10 ng of DNA, 1.6 mM MgCl2, 1× reaction buffer [Promega: 10 mM Tris-HCl (pH 9.0), 50 mM KCl, 0.1% Triton X-100], 0.2 U Taq polymerase (Promega), 0.2 mM of each dNTP, 3 pmol of each primer. PCR products were subsequently separated in 1.5% agarose gels. For genotyping, PCRs were performed as above with the only difference that one fifth of one of the primers of each pair was end-labeled with [γ32P]-ATP, using T4 polynucleotide kinase (MBI, Fermentas) [65]. Amplification was performed on a PTC-100 thermocycler (MJ Research Inc) for 30 cycles of 1 min at 95°C, 1 min at 50°C and 1 min at 72°C. PCR products were electrophoresed on 5% denaturing polyacrylamide gels and visualized by autoradiography.

Data analysis

Genetic variability was measured as the mean number of alleles per locus, effective number of alleles and observed and expected heterozygosity. Conformation to HWE was tested at a significance level of 5%, according to G2 criterion. All computations were performed with POPGENE version 1.31 software [66].

Sequencing of cross-species amplification products

PCR products were electrophoresed, isolated from gel with the 'PCR Clean up and Gel extraction' kit (Nucleospin) and subsequently ligated to the pCR2.1-TOPO vector with the TOPO TA cloning kit (Invitrogen). Recombinant vectors were used to transform E. coli competent cells of the XL-1 strain. Plasmid DNA was extracted with the alkaline lysis method, as above and sequence analysis was performed by Macrogen Inc (Korea).

Declarations

Acknowledgements

This research was supported by a grant of the Hellenic General Secretariat of Research and Technology (99 EΔ529). AAA and EES were supported by a Fellowship from the National Fellowship Foundation (Greece). We would like to thank Dr Alan Robinson for providing C. fasciventris, A. ludens, B. dorsalis, B. correcta, B. cucurbitae samples, Dr M. Frommer for B. tryoni and the Campaña Nacional Contra Moscas de la Fruta, Tapachula, Chiapas, Mexico, for providing A. oblique, A. serpentine, A. striata and A. fraterculus.

Authors’ Affiliations

(1)
Department of Biology, University of Patras
(2)
Department of Biochemistry and Biotechnology, University of Thessaly
(3)
Department of Biology, Aristotle University of Thessaloniki
(4)
Department of Genetics and Development, Columbia University

References

  1. Fletcher BS: Life history strategies of tephritid fruit flies. Fruit flies, their biology, natural enemies and control. Edited by: Robinson AS, Hooper G. 1989, Amsterdam: Elsevier Science Publishers, 3B: 195-208.Google Scholar
  2. White IM, Elson-Harris MM: Fruit Flies of Economic Significance: Their Identification and Bionomics. 1994, CAB International & ACIAR, WallingfordGoogle Scholar
  3. Smith JJ, Bush GL: Phylogeny of the genus Rhagoletis (diptera: tephritidae) inferred from DNA sequences of mitochondrial cytochrome oxidase II. Molecular Phylogenetics and Evolution. 1997, 7 (1): 33-43. 10.1006/mpev.1996.0374.PubMedView ArticleGoogle Scholar
  4. Drew RAI: The tropical fruit flies (Diptera: Tephritidae: Dacinae) of the Australasian and Oceanian regions. 1989, Memoirs – Queensland Museum, 26-Google Scholar
  5. Drew RAI, Hancock DL: Phylogeny of the tribe Dacini (Dacinae) based on morphological, distributional, and biological data. Fruit Flies (Tephritidae): Phylogeny and Evolution of Behavior. Edited by: Aluja M, Norrbom AL. 2000, Boca Raton, FL: CRC Press, 491-504.Google Scholar
  6. Mazomenos BE:Dacus oleae. World crop pests. Edited by: Robinson AS, Hooper G. 1989, Elsevier Science Publishers B.V., Amsterdam, 3B: 169-177.Google Scholar
  7. Montiel-Bueno A, Jones O: Alternative methods for controlling the olive fly, Bactrocera oleae, involving semio-chemicals. IOBC Wprs Bull. 2002, 25: 1-11.Google Scholar
  8. Aketarawong N, Bonizzoni M, Thanaphum S, Gomulski LM, Gasperi G, Malacrida AR, Gugliemino CR: Inferences on the population structure and colonization process of the invasive oriental fruit fly, Bactrocera dorsalis (Hendel). Molecular Ecology. 2007, 16 (17): 3522-3532. 10.1111/j.1365-294X.2007.03409.x.PubMedView ArticleGoogle Scholar
  9. Baliraine FN, Bonizzoni M, Guglielmino CR, Osir EO, Lux SA, Mulaa FJ, Gomulski LM, Zheng L, Quilici S, Gasperi G, Malacrida AR: Population genetics of the potentially invasive African fruit fly species, Ceratitis rosa and Ceratitis fasciventris (Diptera: Tephritidae). Molecular Ecology. 2004, 13 (3): 683-695. 10.1046/j.1365-294X.2004.02105.x.PubMedView ArticleGoogle Scholar
  10. Duyck P, David P, Junod G, Brunel C, Dupont R, Quilici S: Importance of competition mechanisms in successive invasions by polyphagous tephritids in La Réunion. Ecology. 2006, 87 (7): 1770-1780. 10.1890/0012-9658(2006)87[1770:IOCMIS]2.0.CO;2.PubMedView ArticleGoogle Scholar
  11. Malacrida AR, Gomulski LM, Bonizzoni M, Bertin S, Gasperi G, Guglielmino CR: Globalization and fruitfly invasion and expansion: The medfly paradigm. Genetica. 2007, 131 (1): 1-9. 10.1007/s10709-006-9117-2.PubMedView ArticleGoogle Scholar
  12. Thomas DB: Hot peppers as a host for the Mexican fruit fly Anastrepha ludens (Diptera: Tephritidae). Florida Entomologist. 2004, 87 (4): 603-608. 10.1653/0015-4040(2004)087[0603:HPAAHF]2.0.CO;2.View ArticleGoogle Scholar
  13. Andrewartha HG, Birch LC: Some recent contributions to the study of the distribution and abundance of insects. Annu Rev Entomol. 1960, 5: 219-242. 10.1146/annurev.en.05.010160.001251.View ArticleGoogle Scholar
  14. Whitten MJ: Automated sexing of pupae and its usefulness in control by sterile insects. J Econ Entomol. 1969, 62: 272-273.View ArticleGoogle Scholar
  15. Robinson AS: Genetic sexing strains in Medfly, Ceratitis capitata, Sterile Insect Technique Programmes. Genetica. 2002, 116: 5-13. 10.1023/A:1020951407069.PubMedView ArticleGoogle Scholar
  16. Economopoulos AP, Avtzis N, Zervas G, Tsitsipis J, Haniotakis G, Tsiropoulos G, Manoukas A: Experiments on control of olive fly, Dacus oleae (Gmelin), by combined effect of insecticides and releases of gamma-ray sterilized insects. Journal of Applied Entomology. 1977, 83: 201-215.Google Scholar
  17. Economopoulos AP, Zervas GA: Sterile insect technique and radiation in insect control. IAEA-SM-255/39. 1982, 357-368.Google Scholar
  18. Zouros E, Loukas M: Biochemical and colonization genetics of Dacus oleae (Gmelin). Fruit flies, their biology, natural enemies and control. Edited by: Robinson AS, Hooper G. 1989, Amsterdam: Elsevier Science Publishers, 3B: 75-87.Google Scholar
  19. Augustinos AA, Mamuris Z, Stratikopoulos E, D'Amelio S, Zacharopoulou A, Mathiopoulos KD: Microsatellite analysis of olive fly populations in the mediterranean indicates a westward expansion of the species. Genetica. 2005, 125 (2–3): 231-241. 10.1007/s10709-005-8692-y.PubMedView ArticleGoogle Scholar
  20. Nardi F, Carapelli A, Dallai R, Roderick GK, Frati F: Population structure and colonization history of the olive fly, Bactrocera oleae (Diptera, Tephritidae). Molecular Ecology. 2005, 14 (9): 2729-2738. 10.1111/j.1365-294X.2005.02610.x.PubMedView ArticleGoogle Scholar
  21. Mavragani-Tsipidou P: Genetic and cytogenetic analysis of the olive fruit fly Bactrocera oleae (Diptera: Tephritidae). Genetica. 2002, 116 (1): 45-57. 10.1023/A:1020907624816.PubMedView ArticleGoogle Scholar
  22. Lagos D, Koukidou M, Savakis C, Komitopoulou K: The transformer gene in Bactrocera oleae: The genetic switch that determines its sex fate. Insect Molecular Biology. 2007, 16 (2): 221-230. 10.1111/j.1365-2583.2006.00717.x.PubMedView ArticleGoogle Scholar
  23. Lagos D, Ruiz MF, Saìnchez L, Komitopoulou K: Isolation and characterization of the Bactrocera oleae genes orthologous to the sex determining Sex-lethal and doublesex genes of Drosophila melanogaster. Gene. 2005, 348 (1–2 SUPPL.): 111-121. 10.1016/j.gene.2004.12.053.PubMedView ArticleGoogle Scholar
  24. Koukidou M, Klinakis A, Reboulakis C, Zagoraiou L, Tavernarakis N, Livadaras I, Economopoulos A, Savakis C: Germ line transformation of the olive fly Bactrocera oleae using a versatile transgenesis marker. Insect Molecular Biology. 2006, 15 (1): 95-103. 10.1111/j.1365-2583.2006.00613.x.PubMedView ArticleGoogle Scholar
  25. Bruford MW, Wayne RK: Microsatellites and their application to population genetic studies. Current Opinion in Genetics and Development. 1993, 3 (6): 939-943. 10.1016/0959-437X(93)90017-J.PubMedView ArticleGoogle Scholar
  26. Schlötterer C, Pemberton J: The use of microsatellites for genetic analysis of natural populations. EXS. 1994, 69: 203-214.PubMedGoogle Scholar
  27. Tautz D, Schlötterer C: Simple sequences. Curr Opin Genet Dev. 1994, 4: 832-837. 10.1016/0959-437X(94)90067-1.PubMedView ArticleGoogle Scholar
  28. Bonizzoni M, Malacrida AR, Guglielmino CR, Gomulski LM, Gasperi G, Zheng L: Microsatellite polymorphism in the mediterranean fruit fly, Ceratitis capitata. Insect Molecular Biology. 2000, 9 (3): 251-261. 10.1046/j.1365-2583.2000.00184.x.PubMedView ArticleGoogle Scholar
  29. Bonizzoni M, Zheng L, Guglielmino CR, Haymer DS, Gasperi G, Gomulski LM, Malacrida AR: Microsatellite analysis of medfly bioinfestations in California. Molecular Ecology. 2001, 10 (10): 2515-2524. 10.1046/j.0962-1083.2001.01376.x.PubMedView ArticleGoogle Scholar
  30. Bonizzoni M, Guglielmino CR, Smallridge CJ, Gomulski M, Malacrida AR, Gasperi G: On the origins of medfly invasion and expansion in Australia. Molecular Ecology. 2004, 13 (12): 3845-3855. 10.1111/j.1365-294X.2004.02371.x.PubMedView ArticleGoogle Scholar
  31. Gasperi G, Bonizzoni M, Gomulski LM, Murelli V, Torti C, Malacrida AR, Guglielmino CR: Genetic differentiation, gene flow and the origin of infestations of the medfly, Ceratitis capitata. Genetica. 2002, 116: 125-135. 10.1023/A:1020971911612.PubMedView ArticleGoogle Scholar
  32. Stratikopoulos EE, Augustinos AA, Petalas YG, Vrahatis MN, Mintzas A, Mathiopoulos KD, Zacharopoulou A: An integrated genetic and cytogenetic map for the Mediterranean fruit fly, Ceratitis capitata, based on microsatellite and morphological markers. Genetica. 2008, 133: 147-157. 10.1007/s10709-007-9195-9.PubMedView ArticleGoogle Scholar
  33. Song SD, Drew RAI, Hughes JM: Multiple paternity in a natural population of a wild tobacco fly, Bactrocera cacuminata (Diptera: Tephritidae), assessed by microsatellite DNA markers. Molecular Ecology. 2007, 16 (11): 2353-2361. 10.1111/j.1365-294X.2007.03277.x.PubMedView ArticleGoogle Scholar
  34. Bonizzoni M, Katsoyannos BI, Marguerie R, Guglielmino CR, Gasperi G, Malacrida A, Chapman T: Microsatellite analysis reveals remating by wild Mediterranean fruit fly females, Ceratitis capitata. Molecular Ecology. 2002, 11 (10): 1915-1921. 10.1046/j.1365-294X.2002.01602.x.PubMedView ArticleGoogle Scholar
  35. Kraaijeveld K, Katsoyannos BI, Stavrinides M, Kouloussis NA, Chapman T: Remating in wild females of the Mediterranean fruit fly, Ceratitis capitata. Animal Behaviour. 2005, 69 (4): 771-776. 10.1016/j.anbehav.2004.06.015.View ArticleGoogle Scholar
  36. Augustinos AA, Stratikopoulos EE, Zacharopoulou A, Mathiopoulos KD: Polymorphic microsatellite markers in the olive fly, Bactrocera oleae. Molecular Ecology Notes. 2002, 2 (3): 278-280. 10.1046/j.1471-8286.2002.00222.x.View ArticleGoogle Scholar
  37. Bachtrog D, Weiss S, Zangerl B, Brem G, Schlötterer C: Distribution of dinucleotide microsatellites in the Drosophila melanogaster genome. Mol Biol Evol. 1999, 16 (5): 602-610.PubMedView ArticleGoogle Scholar
  38. Katti MV, Ranjekar PK, Gupta VS: Differential distribution of simple sequence repeats in eukaryotic genome sequences. Mol Biol Evol. 2001, 18 (7): 1161-1167.PubMedView ArticleGoogle Scholar
  39. Schug MD, Wetterstrand KA, Gaudette MS, Lim RH, Hutter CM, Aquadro CF: The distribution and frequency of microsatellite loci in Drosophila melanogaster. Molecular Ecology. 1998, 7: 57-70. 10.1046/j.1365-294x.1998.00304.x.PubMedView ArticleGoogle Scholar
  40. Hutter CM, Schug MD, Aquadro CF: Microsatellite variation in Drosophila melanogaster and Drosophila simulans: A reciprocal test of the ascertainment bias hypothesis. Mol Biol Evol. 1998, 15 (12): 1620-1636.PubMedView ArticleGoogle Scholar
  41. Zheng L, Benedict MQ, Cornel AJ, Collins FH, Kafatos FC: An integrated genetic map of the African human malaria vector mosquito, Anopheles gambiae. Genetics. 1996, 143: 941-952.PubMedPubMed CentralGoogle Scholar
  42. Estoup A, Solignac M, Harry M, Cornuet J: Characterization of (GT)(n) and (CT)(n) microsatellites in two insect species: Apis mellifera and Bombus terrestris. Nucleic Acids Research. 1993, 21 (6): 1427-1431. 10.1093/nar/21.6.1427.PubMedPubMed CentralView ArticleGoogle Scholar
  43. Kinnear MW, Bariana HS, Sved JA, Frommer M: Polymorphic microsatellite markers for population analysis of a tephritid pest species, Bactrocera tryoni. Molecular Ecology. 1998, 7 (11): 1489-1495. 10.1046/j.1365-294x.1998.00480.x.PubMedView ArticleGoogle Scholar
  44. Reddy KD, Abraham EG, Nagaraju J: Microsatellites in the silkworm, Bombyx mori: Abundance, polymorphism, and strain characterization. Genome. 1999, 42 (6): 1057-1065. 10.1139/gen-42-6-1057.PubMedView ArticleGoogle Scholar
  45. Noor MAF, Schug MD, Aquadro CF: Microsatellite variation in populations of Drosophila pseudoobscura and Drosophila persimilis. Genetical Research. 2000, 75 (1): 25-35. 10.1017/S0016672399004024.PubMedView ArticleGoogle Scholar
  46. Harr B, Schlötterer C: Patterns of microsatellite variability in the Drosophila melanogaster complex. Genetica. 2004, 120 (1–3): 71-77. 10.1023/B:GENE.0000017631.00820.49.PubMedView ArticleGoogle Scholar
  47. Rubinsztein DC, Amos W, Leggo J, Goodburn S, Jain S, Li S, Margolis RL, Ross CA, Ferguson-Smith MA: Microsatellite evolution – Evidence for directionality and variation in rate between species. Nature Genetics. 1995, 10 (3): 337-343. 10.1038/ng0795-337.PubMedView ArticleGoogle Scholar
  48. Segura MD, Callejas C, Fernaìndez MP, Ochando MD: New contributions towards the understanding of the phylogenetic relationships among economically important fruit flies (Diptera: Tephritidae). Bulletin of Entomological Research. 2006, 96 (3): 279-288. 10.1079/BER2006425.PubMedView ArticleGoogle Scholar
  49. Han HY: Molecular phylogenetic study of the tribe Trypetini (Diptera: Tephritidae), using mitochondrial 16S ribosomal DNA sequences. Biochemical systematics and Ecology. 2000, 120: 501-513. 10.1016/S0305-1978(99)00097-6.View ArticleGoogle Scholar
  50. Han HY, McPheron BA: Molecular phylogenetic study of tephritidae (insecta: diptera) using partial sequences of the mitochondrial 16S ribosomal DNA. Molecular phylogenetics and Evolution. 1997, 7: 17-32. 10.1006/mpev.1996.0370.PubMedView ArticleGoogle Scholar
  51. Han HY, McPheron BA: Phylogenetic study of selected Tephritid flies (Insecta: Diptera: Tephritidae) using partial sequences of the nuclear 18s ribosomal DNA. Biochemical systematics and Ecology. 1994, 22: 444-457. 10.1016/0305-1978(94)90040-X.View ArticleGoogle Scholar
  52. Chirhart SE, Honeycutt RL, Greenbaum IF: Microsatellite variation and evolution in the Peromyscus maniculatus species group. Molecular Phylogenetics and Evolution. 2005, 34 (2): 408-415. 10.1016/j.ympev.2004.10.018.PubMedView ArticleGoogle Scholar
  53. Goldstein DB, Pollock DD: Launching microsatellites: A review of mutation processes and methods of phylogenetic inference. Journal of Heredity. 1997, 88 (5): 335-342.PubMedView ArticleGoogle Scholar
  54. Schlötterer C: Genealogical inference of closely related species based on microsatellites. Genetical Research. 2001, 78: 209-212. 10.1017/S0016672301005444.PubMedView ArticleGoogle Scholar
  55. Kounatidis I, Papadopoulos N, Bourtzis K, Mavragani-Tsipidou P: Genetic and cytogenetic analysis of the fruit fly Rhagoletis cerasi (Diptera: Tephritidae). Genome. 2008, 51 (7): 479-491. 10.1139/G08-032.PubMedView ArticleGoogle Scholar
  56. Zacharopoulou A: Polytene chromosome maps in the Medfly Ceratitis capitata. Genome. 1990, 33: 184-197.Google Scholar
  57. Zacharopoulou A, Frisardi M, Savakis C, Robinson AS, Tolias P, Konsolaki M, Komitopoulou K, Kafatos FC: The genome of the Mediterranean fruit fly C. capitat a: Localization of molecular markers by in situ hybridization to salivary gland polytene chromosomes. Chromosoma. 1992, 101: 448-455. 10.1007/BF00582839.PubMedView ArticleGoogle Scholar
  58. Tsitsipis JA: An improved method for the mass rearing of the olive fruit fly, Dacus oleae (Gmel.) (Diptera, Tephritidae). Z Angrew Entomol. 1977, 83: 419-426.View ArticleGoogle Scholar
  59. Tsitsipis JA: Development of a caging and egging system for mass rearing the olive fruit fly, Dacus oleae (Gmel.) (Diptera, Tephritidae). Ann Zool Ecol Anim. 1977, 9: 133-139.Google Scholar
  60. Tzanakakis ME, Economopoulos AP, Tsitsipis JA: The importance of conditions during the adult stage in evaluating an artificial food for larvae of Dacus oleae (Gmel.) (Diptera, Tephritidae). Z Angew Entomol. 1967, 59: 127-130.View ArticleGoogle Scholar
  61. Ashburner M: Drosophila: A Laboratory Manual. 1989, New York: Cold Spring Harbour Laboratory PressGoogle Scholar
  62. Sambrook J, Fritch EF, Maniatis T: Molecular Cloning: A Laboratory Manual. 1989, Cold Spring Harbor, NY. 21: Cold Spring Harbor Laboratory pressGoogle Scholar
  63. Schlötterer C: Microsatellites. Molecular Genetic Analysis of Populations: a practical approach. Edited by: Hoelzel AR. 1998, Oxford University Press, 238-245.Google Scholar
  64. Zambetaki A, Zacharopoulou A, Scouras ZG, Mavragani-Tsipidou P: The genome of the olive fruit fly Bactrocera oleae: Localization of molecular markers by in situ hybridization to the salivary gland polytene chromosomes. Genome. 1999, 42 (4): 744-751. 10.1139/gen-42-4-744.View ArticleGoogle Scholar
  65. Zheng L: Microsatellite mapping of insect genomes. Molecular Biology of Insect Disease Vectors: A methods manual. Edited by: Crampton JM, Beard CB, Louis C. 1997, Chapman & Hall, 321-329.View ArticleGoogle Scholar
  66. Yeh FC, Yang RC, Boyle TBJ, Ye ZH, Mao JX: POPGENE, the user-friendly shareware for population genetic analysis. 1997, Molecular Biology and Biotechnology Centre, University of Alberta, CanadaGoogle Scholar

Copyright

© Augustinos et al; licensee BioMed Central Ltd. 2008

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Advertisement