Open Access

"Tandem duplication-random loss" is not a real feature of oyster mitochondrial genomes

BMC Genomics200910:84

DOI: 10.1186/1471-2164-10-84

Received: 14 November 2008

Accepted: 19 February 2009

Published: 19 February 2009

Abstract

Duplications and rearrangements of coding genes are major themes in the evolution of mitochondrial genomes, bearing important consequences in the function of mitochondria and the fitness of organisms. Yu et al. (BMC Genomics 2008, 9:477) reported the complete mt genome sequence of the oyster Crassostrea hongkongensis (16,475 bp) and found that a DNA segment containing four tRNA genes (trnK 1 , trnC, trnQ 1 and trnN), a duplicated (rrnS) and a split rRNA gene (rrnL5') was absent compared with that of two other Crassostrea species. It was suggested that the absence was a novel case of "tandem duplication-random loss" with evolutionary significance. We independently sequenced the complete mt genome of three C. hongkongensis individuals, all of which were 18,622 bp and contained the segment that was missing in Yu et al.'s sequence. Further, we designed primers, verified sequences and demonstrated that the sequence loss in Yu et al.'s study was an artifact caused by placing primers in a duplicated region. The duplication and split of ribosomal RNA genes are unique for Crassostrea oysters and not lost in C. hongkongensis. Our study highlights the need for caution when amplifying and sequencing through duplicated regions of the genome.

Background

Because of its nature of maternal inheritance, mitochondrial (mt) genome has a fast rate of evolution and is particularly useful in phylogenetic analysis. The analysis of complete mt genome sequences provides not only information about nucleotide changes, but also insights into gene order and rearrangements that are indicative of major evolutionary changes.

We read with great interest an article appeared in a recent issue of BMC Genomics (9:477 2008) entitled 'Complete mitochondrial DNA sequence of oyster Crassostrea hongkongensis – a case of "Tandem duplication-random loss" for genome rearrangement in Crassostrea?' by Yu, Z.N., Wei, Z.P., Kong, X.Y., and Shi, W. [1]. Based on our data, we believe that an important part of Yu et al.'s paper is incorrect and would like to share our results with the readers of this Journal.

In their paper, Yu et al. (2008) reported that the complete mt genome of C. hongkongensis is 16,475 bp in length (GenBank accession number EU266073) and pointed out that 'A striking finding of this study is that a DNA segment containing four tRNA genes (trnK 1 , trnC, trnQ 1 and trnN) and two duplicated or split rRNA genes (rrnL5' and rrnS) are absent from the genome, when compared with that of two other extant Crassostrea species, which is very likely a consequence of loss of a single genomic region present in ancestor of C. hongkongensis. It indicates this region seem to be a "hot spot" of genomic rearrangements over the Crassostrea mt-genomes' (p. 1, Abstract, line 14–19). We have independently sequenced the complete mt genomes of three C. hongkongensis individuals. All our three sequences contained the DNA segment that was reported missing in Yu et al.'s study. The discrepancy is not trivial as the loss of the duplicated region was central to Yu et al.'s hypothesis of a novel "tandem duplication and random loss" event during the evolution of C. hongkongensis. It was further suggested that this region was a "hot spot" for genomic rearrangement. Therefore, it is critical to determine if the loss of the duplicated region is real in view of the different sequences we obtained.

To determine which sequence is correct, we analyzed our sequences, compared them with Yu et al.'s sequence and sequences from other Crassostrea species, and designed primers to test the presence or absence of the genome region in question. Here we report that Yu et al.'s sequence is either incorrect or represent a rare mutation that is uncommon in C. hongkongensis.

Experimental design, results and discussion

The three complete mt genome sequences of C. hongkongensis that we independently obtained were submitted to GenBank: accession No. EU672834 for oyster HN from Hainan, FJ593172 for oyster BH45 from Guangxi, and FJ593173 for oyster H50 from Fujian. The length of the complete mt genome of C. hongkongensis reported by Yu et al. is 16,475 bp. The length of all three mt sequences that we obtained is 18,622 bp, which is 2,147 bp longer than that of Yu et al.'s. We aligned our sequences with that of Yu et al. and other Crassostrea species. We annotated our mt sequences according to that of C. gigas with minor revisions [2], and the results are presented in Table 1. Our sequence for C. hongkongensis has exactly the same gene order and arrangements as C. gigas, both containing the segment that is missing in Yu et al.'s sequence. The segment contains four tRNA genes, a duplicated rrnS and part of the split rrnL. The split rrnL is first discovered in C. virginica and appears to be unique for oysters [2].
Table 1

Annotation of the mitochondrial genome of Crassostrea hongkongensis.

Gene

Position

Size

Codon

Intergenic Nucleotides*

  

Nucleotide

Amino acids

Start

Stop

 

cox1

1–1617

1617

538

ATA

TAA

1

rrnL 3'half

1761–2472

712

   

143

cox3

2575–3438

864

287

ATA

TAA

231

trnI

3439–3505

67

   

0

trnT

3506–3573

68

   

0

trnE

3595–3662

68

   

21

cob

3670–4875

1206

401

ATA

TAA

130

trnD

4984–5052

69

   

108

cox2

5054–5755

702

233

ATG

TAG

1

trnM 1 (ATG)

5777–5842

66

   

21

trnS 1 (AGN)

5846–5915

70

   

3

trnL 2 (UUR)

5931–5997

67

   

15

trnM 2 (ATG)

6065–6129

65

   

67

trnS 2 (UCN)

6137–6204

68

   

7

trnP

6383–6451

69

   

178

rrnS 1

6452–7525

1074

   

0

trnK 1

7526–7594

69

   

0

trnC

7624–7691

68

   

29

trnQ 1 (CAA)

7709–7777

69

   

17

rrnL 5'half

7780–8384

605

   

1

trnN

8443–8508

66

   

58

rrnS 2

8509–9698

1190

   

0

trnY

9699–9764

66

   

0

atp6

9770–10453

684

227

ATG

TAG

5

trnG

10966–11035

70

   

512

trnV

11644–11716

73

   

608

nad2

11759–12757

999

332

ATG

TAG

42

trnR

12792–12858

67

   

34

trnH

12919–12983

65

   

60

nad4

12986–14335

1350

449

ATA

TAG

2

trnK 2 (AAA)

14343–14417

75

   

7

nad5

14419–16089

1671

556

ATG

TAA

1

nad6

16101–16576

476

158

ATT

TA-

11

trnQ 2 (CAA)

16610–16678

69

   

33

nad3

16684–17034

351

116

ATG

TAG

5

trnL 1 (CUN)

17070–17135

66

   

35

trnF

17171–17238

68

   

35

trnA

17259–17325

67

   

20

nad1

17331–18266

936

311

ATG

TAA

5

nad4L

18270–18549

280

93

ATG

T-

3

trnW

18550–18618

69

22

  

0

"-" indicates termination codons completed via polyadenylation.

Underlined genes correspond to a segment missing in Yu et al.' sequence due to a sequencing artifact.

The three C. honghongensis oysters used in our study were from diverse populations (Hainan, Guangxi and Fujian) covering the entire geographic range of this species as we know (Guo et al., unpublished), and they were genetically identified using molecular markers prior to our study [3]. We compared one of our sequences with Yu et al.'s using BLAST http://blast.ncbi.nlm.nih.gov/bl2seq/wblast2.cgi[4]. In the 16,475 shared nucleotides, there are 15 SNPs (single nucleotide polymorphisms) and the similarity between the two gnomes is 99.91%, suggesting that oysters used in our study and Yu et al.'s study are all C. hongkongensis. Sequence identity in major coding genes between our C. hongkongensis sequences and that of C. gigas is shown in Table 2. Considerable differentiation has occurred between the two sister-species at some genes (i.e., gene identity of 75.1% for nad2) despite the identical gene order. Analysis of all four C. hongkongensis mt sequences revealed 41 SNPs: 28 in coding and 13 in non-coding regions (Table 3). Of the 19 SNPs from protein coding genes, only one is non-synonymous, suggesting strong purifying selection. The non-synonymous mutation occurred at the atp6 gene in Yu's sequence only, and further studies are needed to determine whether it is a true SNP or sequencing error.
Table 2

Sequence identity of major coding genes between Crassostrea hongkongensis and C. gigas.

Gene

Number of nucleotides

Identity (%)

Number of amino acids

Identity (%)

 

C. hongkongensis

C. gigas

 

C. hongkongensis

C. gigas

 

cox1

1617

1617

87.4

538

538

98.0

cox2

702

702

87.6

233

233

98.7

cox3

864

876

82.7

287

291

89.7

nad1

936

936

82.7

311

311

87.8

nad2

999

999

75.1

332

332

72.6

nad3

351

351

82.3

116

116

86.2

nad4

1350

1353

78.3

449

450

81.8

nd4L

280

283

82.3

93

94

93.5

nad5

1671

1671

77.1

556

556

80.2

nad6

476

477

77.6

158

158

77.2

cob

1223

1248

79.5

401

412

88.0

atp6

684

684

84.5

227

227

97.4

rrnS 1

1074

1037

93.2

   

rrnS 2

1190

1205

89.9

   

rrnL 5'

605

601

88.4

   

rrnL 3'

712

713

95.8

   
Table 3

Single-nucleotide polymorphism (SNP) observed among four mitochondrial genome sequences of Crassostrea hongkongensis.

Gene

Position

HN

BH45

HC50

Yu1

Type

cox1 (1–1617)

930

C

C

A

C

Transversion, synonymous

 

993

C

C

C

T

Transition, synonymous

 

1395

T

T

T

C

Transition, synonymous

cox3 (2575–3438)

2805

G

A

G

G

Transition, synonymous

 

3282

G

T

G

G

Transversion, synonymous

cob (3670–4875)

4611

T

C

T

T

Transition, synonymous

cob-trnD (4876–4983)

4883

C

C

C

T

Transition

cox2 (5054–5755)

5533

A

G

G

G

Transition, synonymous

cox2-trnS 1 (5756–5845)

5845

T

G

G

G

Transversion

rrnS 1 (6452–7525)

7225

C

T

C

-

Transition

 

7325

C

C

T

-

Transition

rrnL-trnN (8385–8442)

8407

T

C

T

-

Transition

rrnS 2 (8509–9698)

8567

C

T

C

-

Transition

 

8832

A

A

A

G

Transition

 

9036

G

G

T

G

Transversion

 

9219

T

C

T

T

Transition

 

9372

C

T

C

C

Transition

atp6 (9770–10453)

10025

T

T

T

C

Transition, nonsynonymous

atp6-trnG (10454–10965)

10524

G

T

G

G

Transversion

 

10673

G

A

G

G

Transition

 

10712

C

C

T

C

Transition

 

10778

A

G

G

G

Transition

 

10836

C

T

C

C

Transition

 

10870

T

C

T

T

Transition

trnG-trnV (11036–11643)

11502

C

G

G

G

Transversion

 

11509

C

T

T

T

Transition

 

11638

T

C

T

T

Transition

trnV (11644–11716)

11699

T

C

T

C

Transition

 

11701

G

A

A

A

Transition

nad2 (11759–12757)

12070

A

G

A

A

Transition, synonymous

nad4 (12986–14335)

13232

T

C

T

T

Transition, synonymous

 

13678

C

A

C

C

Transversion, synonymous

nad5 (14419–16089)

15159

A

G

G

G

Transition, synonymous

 

15216

T

C

T

T

Transition, synonymous

 

15321

G

G

T

G

Transversion, synonymous

 

15552

A

A

A

G

Transition, synonymous

 

15645

T

T

C

T

Transition, synonymous

nad6-trnQ2 (16577–16609)

16590

C

C

T

C

Transition

nad3 (16684–17034)

16986

A

G

G

G

Transition, synonymous

nad1 (17331–18266)

17876

T

C

T

T

Transition, synonymous

 

18134

A

A

G

A

Transition, synonymous

1Sequence for Yu is from Yu et al., 2008, and the other three sequences are from this study.

Yu et al. used ten pairs of primers to amplify the complete mt genome of C. hongkongensis (p. 11). We carefully studied the positions of each primer and located them in our mt genome sequences of C. hongkongensis (Figure 1). It occurred to us that Yu et al. might have failed to amplify the gene block of K 1 -C-Q 1 -rrnL 5'-N-rrnS 2 because some of their primers were placed in a duplicated region. As shown in Figure 1, primer pair 1* is located in gene cob and rrnS 1 (or rrnS 2 ), primer pair 2* is completely located within the duplicated gene rrnS (rrnS 1 or/and rrnS 2 ), and primer pair 3* is located in rrnS 2 (or rrnS 1 ) and atp6 (primer pairs 1*, 2* and 3* correspond to the third, the fourth and the fifth primer pairs in Yu et al.' paper, Table 4). Because these three primer pairs are either completely or partially (one of the two primers) located in the duplicated gene rrnS 1 and rrnS 2 , they should theoretically amplify two fragments of different length, but in reality the smaller fragment may be preferentially amplified and sequenced. The length of shortest PCR products expected from the three primer pairs was 2,470 bp, 824 bp and 1,016 bp, respectively (Table 4). Primer pair 2* was completely located in the duplicated gene rrnS (rrnS 1 or rrnS 2 ); thus they may directly concatenate the sequence between the duplicated gene and artificially lose the gene block of K1-C-Q1-rrnL 5'-N-rrnS 2 (Figure 1). The block, 2,147 bp, may be too large to be amplified under competition with a smaller fragment.
https://static-content.springer.com/image/art%3A10.1186%2F1471-2164-10-84/MediaObjects/12864_2008_Article_1968_Fig1_HTML.jpg
Figure 1

Position map of the primers used in amplifying fragments of C. hongkongensis mitochondrial genome. Above the gene map are the three pairs of primers used by Yu et al. (2008) and below are the two pairs of primers designed to confirm the existence of the gene block in red, which is reported missing by Yu et al. Gene segments are not drawn to scale.

Table 4

Primers used to amplify fragments of Crassostrea hongkongensis mitochondrial genome.

Order

Primer name

Sequence (5'-3')

Length

position

Product size (bp)

1*

HK-4343F

TTAGAGTTCCGTTTCACCCG

20

4343

2470, 4617

 

HK-6812R

CTTTCGCTTCAATTTAGTTAGT

22

6812, 8959

 

2*

HK-6569F

GGTTCTGGTATAATGTTAGCT

21

6569, 8716

824, 2971

 

HK-7392R

ATTACTCTCTTTTTACTCCC

20

7392, 9539

 

3*

HK-9412F

CTAGGTCAGGTCGAAGTGCT

20

7265, 9412

1016, 3163

 

HK-10427R

AGAGCACAGGTGTTGGGTGA

20

10427

 

4

HK-5807F

GTCTCATAATCCGAAAGTGGTT

22

5807

2658

 

HK-8464R

CTTATACTTGGGCTACTTTCTT

22

8464

 

5

HK-8138F

GGTGCTCACTAAATCAGTATGT

22

8138

1905

 

HK-10043R

ATGAAGATAGTGACGGAAACCC

22

10043

 

*Primer pairs from Yu et al. (2008). Because one or both of the primers are located in the duplicated rrnS gene, two fragments are expected but only the shorter one is actually amplified.

To test our hypothesis that the gene block between duplicated rrnS failed to amplify in Yu et al.'s study, we synthesized the three primer pairs used by Yu et al. (after removing mismatches based on our C. hongkongensis sequences to improve specificity). As expected, the three shorter products mentioned in Yu et al.' paper were successfully obtained (Table 4, Figure 2). We increased the elongation time for PCR trying to obtain the longer fragments, but failed probably because of distance between the duplicated genes (2,147 bp) is too long. We designed two new pairs of primers targeting the block between the duplicated rrnS genes, with one primer of each pair located in the rrnL gene that was supposed to be absent according to Yu et al. (Table 4, Fig, 1). The two new primer pairs designed by us successfully amplified and produced fragments of expected sizes, 2,658 and 1,905 bp (Table 4, Figure 2), proving that the gene block between the duplicated rrnS genes are actually there. To further confirm that the two products both contain the duplicated rrnS, each product was used as PCR template for amplification with the primers 2* that amplifies rrnS only; both PCR produced a fragment of the expected size (824 bp), the same as using genomic DNA as template (Figure 2). We also sequenced some of the fragments, and the sequences are the same as expected from the mt sequences we obtained. These results clearly demonstrate that the duplicated rrnS and the split rrnL exist in the mt genome of C. hongkongensis. There is no loss of the duplicated genes and the gene block between them. "Tandem duplication-random loss" is not a real feature of oyster mt genomes and has not occurred during the evolution of C. hongkongensis. The possibility of Yu et al. sequenced a rare mutant of C. hongkongensis is extremely low considering: 1) we sequenced three individuals from three diverse populations; 2) Yu and colleagues screened more than one individual; and 3) we duplicated their results with our samples. This is a clear case of PCR artifacts involving duplicated genes.
https://static-content.springer.com/image/art%3A10.1186%2F1471-2164-10-84/MediaObjects/12864_2008_Article_1968_Fig2_HTML.jpg
Figure 2

PCR products amplified with different primers and separated on agarose gel electrophoresis. P1 - P3 are the products amplified using the primer pairs 1* – 3* and P4, P5 are the products amplified with the primers 4, 5 with genomic DNA template; while P6, P7 are the products amplified using the primers 2* with P4 and P5 as templates, respectively. M1: 1 Kb DNA Ladder marker 10000, 8000, 7000, 6000, 5000, 4000, 3000, 2000 and 1000 bp; M2: D2000 marker 2000, 1 000, 750, 500, 250 and 100 bp.

Conclusion

In conclusion, the complete mt genome of C. hongkongensis is 18,622 bp in length, and its gene order and arrangement are identical to that of C. gigas. The loss of a gene segment reported by Yu et al. (2008) was an artifact due to placing PCR primers in a duplicated gene, and the phenomenon of "tandem duplication-random loss" does not exist in the mt genome of C. hongkongensis. Our study highlights the need for caution when amplifying and sequencing through regions with tandem duplication. When tandem duplication is expected, it is important to design long PCR fragments and not place primers in duplicated regions. Cross-verification with different sets of primers should be considered.

Declarations

Acknowledgements

We acknowledge that Drs. Patrick Gaffney and Coren Milbury independently identified the potential problem in the published mt genome sequence and communicated with us during manuscript preparation. This work is supported by the MFG Fund of Chinese Academy of Sciences. Sample collection is supported by grants from US NOAA CBO (NA04NMF4570424) and NSFC (08201101B, 39825121 and 40406032).

Authors’ Affiliations

(1)
Institute of Oceanology, Chinese Academy of Sciences
(2)
Beijing Institute of Genomics, Chinese Academy of Sciences
(3)
The Graduate University of Chinese Academy of Sciences
(4)
Haskin Shellfish Research Laboratory, Institute of Marine and Coastal Sciences, Rutgers University

References

  1. Yu ZN, Wei ZP, Kong XY, Shi W: Complete mitochondrial DNA sequence of oyster Crassostrea hongkongensis -a case of "Tandem duplication-random loss" for genome rearrangement in Crassostrea?. BMC Genomics. 2008, 9: 477-10.1186/1471-2164-9-477.PubMed CentralView ArticlePubMedGoogle Scholar
  2. Milbury CA, Gaffney PM: Complete mitochondrial DNA sequence of the eastern oyster Crassostrea virginica. Mar Biotechnol. 2005, 7: 697-712. 10.1007/s10126-005-0004-0.View ArticlePubMedGoogle Scholar
  3. Wang H, Guo X: Identification of Crassostrea ariakensis and related oysters by multiplex species-specific PCR. J Shellfish Res. 2008, 27: 481-487. 10.2983/0730-8000(2008)27[481:IOCAAR]2.0.CO;2.View ArticleGoogle Scholar
  4. Tatusova TA, Madden TL: Blast 2 sequences – a new tool for comparing protein and nucleotide sequences. FEMS Microbiol Lett. 1999, 174: 247-250. 10.1111/j.1574-6968.1999.tb13575.x.View ArticlePubMedGoogle Scholar

Copyright

© Ren et al; licensee BioMed Central Ltd. 2009

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.