Stage-specific expression of protease genes in the apicomplexan parasite, Eimeria tenella

  • Marilyn Katrib1,

    Affiliated with

    • Rowan J Ikin1,

      Affiliated with

      • Fabien Brossier3,

        Affiliated with

        • Michelle Robinson1,

          Affiliated with

          • Iveta Slapetova1,

            Affiliated with

            • Philippa A Sharman2,

              Affiliated with

              • Robert A Walker2,

                Affiliated with

                • Sabina I Belli1,

                  Affiliated with

                  • Fiona M Tomley4 and

                    Affiliated with

                    • Nicholas C Smith2Email author

                      Affiliated with

                      BMC Genomics201213:685

                      DOI: 10.1186/1471-2164-13-685

                      Received: 31 August 2012

                      Accepted: 4 December 2012

                      Published: 7 December 2012

                      Abstract

                      Background

                      Proteases regulate pathogenesis in apicomplexan parasites but investigations of proteases have been largely confined to the asexual stages of Plasmodium falciparum and Toxoplasma gondii. Thus, little is known about proteases in other Apicomplexa, particularly in the sexual stages. We screened the Eimeria tenella genome database for proteases, classified these into families and determined their stage specific expression.

                      Results

                      Over forty protease genes were identified in the E. tenella genome. These were distributed across aspartic (three genes), cysteine (sixteen), metallo (fourteen) and serine (twelve) proteases. Expression of at least fifteen protease genes was upregulated in merozoites including homologs of genes known to be important in host cell invasion, remodelling and egress in P. falciparum and/or T. gondii. Thirteen protease genes were specifically expressed or upregulated in gametocytes; five of these were in two families of serine proteases (S1 and S8) that are over-represented in the coccidian parasites, E. tenella and T. gondii, distinctive within the Apicomplexa because of their hard-walled oocysts. Serine protease inhibitors prevented processing of EtGAM56, a protein from E. tenella gametocytes that gives rise to tyrosine-rich peptides that are incorporated into the oocyst wall.

                      Conclusion

                      Eimeria tenella possesses a large number of protease genes. Expression of many of these genes is upregulated in asexual stages. However, expression of almost one-third of protease genes is upregulated in, or confined to gametocytes; some of these appear to be unique to the Coccidia and may play key roles in the formation of the oocyst wall, a defining feature of this group of parasites.

                      Keywords

                      Eimeria Apicomplexa Protease Protease inhibitors Gametocyte Oocyst wall

                      Background

                      Proteases are essential regulators of pathogenesis in the Apicomplexa, a phylum that includes obligate, intracellular protozoan parasites of great human health (e.g., Plasmodium species, causing malaria, Toxoplasma gondii, causing toxoplasmosis, and Cryptosporidium, causing cryptosporidiosis) and agricultural and economic significance (e.g., Neospora caninum, the cause of foetal abortion in cattle, and Eimeria species, the causative agents of coccidiosis in poultry, cattle, sheep and rabbits). Extensive study of Plasmodium species and T. gondii has established that proteases help to coordinate and regulate the lifecycles of these parasites, playing key roles in host cell invasion, general catabolism, host cell remodelling and egress from host cells [1]. These processes are all associated with the asexual stages of apicomplexan parasites. By contrast, relatively little is known about what roles proteases may play in the sexual phase of the apicomplexan lifecycle though it is known that a subtilisin 2 is detected specifically in the gametocyte proteome [2] and expression of falcipain 1 is upregulated in gametocytes [3] of P. falciparum. Moreover, it has been demonstrated that the cysteine protease inhibitor, E64d, or the targeted genetic disruption of falcipain 1 can inhibit oocyst production in P. falciparum[3, 4]. Likewise, the proteosome inhibitors, epoxomicin and thiostrepin, exhibit gametocytocidal activity [5, 6].

                      In comparison to P. falciparum and T. gondii, proteases from Eimeria species have been studied far less intensively, despite the economic importance of this genus of parasites. Thus, homologs or orthologs of several classes of proteases found in P. falciparum and/or T. gondii have also been identified in Eimeria species including an aspartyl protease [710], an aminopeptidase [11], a rhomboid protease [12, 13], a subtilisin 2-like protease [10, 13, 14], three cathepsin Cs [15], a cathepsin L [15] and an orthologue of toxopain, a cathepsin B cysteine protease [14, 15]. As for P. falciparum and T. gondii, these proteases have been found in the asexual stages of Eimeria and are mostly predicted to play roles in host cell invasion, though expression of some of these enzymes is associated with the sporulation of the developing oocyst [11, 13, 15]. However, it is hypothesized that proteolytic processing of two proteins from the wall forming bodies of the macrogametocytes of Eimeria – GAM56 and GAM82 – is essential for the subsequent incorporation of tyrosine-rich peptides into the oocyst wall [16].

                      In this study, we screened the E. tenella genomic database for genes encoding proteases, classified these into clans and families and designed PCR probes for them. Using cDNA produced from E. tenella stage specific mRNA, we carried out semi-quantitative PCR to determine the stage specificity of expression of the protease genes, especially to identify protease mRNAs that were upregulated in gametocytes. In order to further resolve which of these may be involved in oocyst wall formation, we carried out a processing assay using gametocyte extracts of E. tenella, whereby a variety of specific protease inhibitors were tested for their ability to inhibit the processing of GAM56 into smaller, putative oocyst wall proteins.

                      Results

                      Identification of potential protease genes in Eimeria tenella

                      The genome of E. tenella (Houghton strain) was sequenced by the Parasite Genomics Group at the Wellcome Trust Sanger Institute and provided pre-publication for the current analysis. The Parasite Genomics Group plan to publish the annotated sequence in a peer-reviewed journal in the coming future. The E. tenella genome database (http://​www.​genedb.​org/​Homepage/​Etenella) was explored to identify genes that were automatically predicted to code for aspartic, cysteine, metallo and serine proteases. Database mining revealed over 60 gene sequences whose predicted open reading frames were associated with potential peptidase activity. Manual annotation of the genes was performed by BLAST search of apicomplexan genome databases to identify phylogenetically closely related nucleotide sequences and by BLAST search of various protein databases to identify the most closely related, experimentally characterized homologs available (Table 1). Additionally, the predicted proteins were analysed for conserved motifs and domains to further validate protein function (Table 1). Each predicted protein was then assigned a five-tiered level of confidence for function using an Evidence Rating (ER) system (Table 1). The evidence rating system, described previously [17], allocates genes an overall score (ER1-5), indicating how compelling the bioinformatic and experimental evidence is for protein function. An ER1 rating signifies extremely reliable experimental data to support protein function in the particular species being investigated, in this case Eimeria, whereas ER5 indicates no experimental or bioinformatic evidence for gene function. Genes with an ER5 were eliminated from further investigation. After this validation process was performed, 45 putative protease genes remained and these could be classified into clans and families of aspartic, cysteine, metallo and serine proteases (Table 1), including: three aspartic proteases, all within family A1 in clan AA; 16 cysteine proteases, the vast majority (15) of which were in clan CA, five being cathepsins (family C1), one calpain (family C2), eight ubiquitinyl hydrolases (family C19) and one OTU protease (family C88), as well as a single clan CF pyroglutamyl peptidase (family C15); 14 metallo proteases, distributed over five clans (MA (6), ME (5), MF (1), MK (1) and MM (1)) and seven families (M1 (2), M41 (3), M48 (1), M16 (5), M17 (1), M22 (1) and M50 (1)); and 12 serine proteases in clan PA (three trypsin-like proteases in family S1), clan SB (six subtilisin-like proteases in family S8), clan SC (one prolyl endopeptidase in family S33), clan SK (one Clp protease in family S14) and clan ST (a rhomboid protease – rhomboid protease 1 – in family S54). Three additional rhomboid proteases were identified in the E. tenella genome database by using BLASTP to search the database using, as queries, homologs described in T. gondii: rhomboid protease 3 (ETH_00032220, Supercontig_69: 140161–141340; 4.0e52); rhomboid protease 4 (ETH_00009820, Supercontig_44: 17996–24858; 9.8e-164); and rhomboid protease 5 (ETH_00040480, contig NODE_916_length_3953_cov_17.775614: 53–3466; 7.2e-65). However, we were unable to confirm coding sequences or stage-specific expression for any of these three genes.
                      Table 1

                      Protease genes identified in the Eimeria tenella genome database

                      Protease/Gene Identifier/Contig

                      Clan

                      Family

                      BLAST Apicomplexa (Database: nucleotide)

                      BLAST NCBI (Database: PDB, Swissprot, NR)

                      Family Domains (Pfam, MEROPS, InterProScan)

                      Evidence Rating

                      Aspartic Proteases

                            

                      Eimepsin 1 ETH_00001725 on Supercontig_54

                      AA

                      A1

                      Theileria annulata strain Ankara genomic DNA chromosome 3 (E=2e-17)

                      PDB: Porcine Pepsin (E=4e-11)

                      partial

                      ER1

                      Eimepsin 2 ETH_00007420 on Supercontig_38

                      AA

                      A1

                      Toxoplasma gondii ME49 gcontig_1112359860822 (E=7e-36)

                      NR: aspartic protease 7 [Toxoplasma gondii] (E=3e-37)

                      none

                      ER3/4

                      Eimepsin 3 ETH_00008525 on Supercontig_8

                      AA

                      A1

                      Plasmodium berghei whole genome shotgun assembly, contig PB_RP2841 (E=1e-93)

                      PDB: Human pepsin (E=7e-56)

                      complete

                      ER2

                      Cysteine Proteases

                            

                      Cathepsin B ETH_00003570 on Supercontig_23

                      CA

                      C1

                      Toxoplasma gondii GAB2-2007-GAL-DOM2 contig00350 (E= 1e-12)

                      PDB: Human Recombinant Procathepsin B (E=2e-58)

                      Complete

                      ER2

                      Cathepsin L ETH_00033530 on NODE_2923_length_1315_cov_12.253232

                      CA

                      C1

                      Toxoplasma gondii ME49 gcontig_1112359872114 (E= 9e-43)

                      PDB: Toxoplasma gondii Cathepsin L (Tgcpl) (E=1e-64)

                      Complete

                      ER2

                      Cathepsin C1 ETH_00019750 on Supercontig_2

                      CA

                      C1

                      Toxoplasma gondii ME49 gcontig_1112359873648 (E= 5e-46)

                      PDB: Porcine Cathepsin H (E=3e-11)

                      Partial

                      ER2/3

                      Cathepsin C2 ETH_0005000 on NODE_22022_length_2554_cov_8.124119

                      CA

                      C1

                      Toxoplasma gondii GT1 gcontig_1107000835548 (E=2e-11)

                      PDB: Human Dipeptidyl Peptidase I (Cathepsin C) (E=0.016)

                      Partial

                      ER3/4

                      Cathepsin C3 ETH_00001590, ETH_00001595 and ETH_00001600 on Supercontig_115

                      CA

                      C1

                      Cryptosporidium hominis strain TU502 chromosome 4 CHRO014106 (E=1e-34)

                      PDB: Cathepsin C Rattus norvegicus (E= 3e-13)

                      partial

                      ER2

                      Calpain ETH_00004075 on Supercontig_49

                      CA

                      C2

                      Toxoplasma gondii ME49 gcontig_1112359873650 (E=5e-96)

                      PDB: Human Calpain 8 (E= 1e-16)

                      Complete

                      ER2

                      Ubiquitinyl hydrolase 1 ETH_00012075 on Supercontig_122

                      CA

                      C19

                      Cryptosporidium muris RN66 gcontig_1106632353963 (E=2e-87)

                      Swiss-Prot: ubiquitin specific peptidase 39 [Mus musculus] (E=1e-116)

                      Complete

                      ER2

                      Ubiquitinyl hydrolase 2 ETH_00034675 on Supercontig_3

                      CA

                      C19

                      Cryptosporidium muris RN66 gcontig_1106632353937 (E=3e-35)

                      Swiss-Prot: ubiquitin specific peptidase 5 (isopeptidase T)[Mus musculus] (E=7e-81)

                      Partial

                      ER2

                      Ubiquitinyl hydrolase 3 ETH_00001555 on Supercontig_115

                      CA

                      C19

                      Neospora caninum Liverpool ubiquitin carboxyl-terminal hydrolase, related (NCLIV_041690) mRNA, partial cds (E=63e-94)

                      PDB: Ubp-Family Deubiquitinating Enzyme [human] (E= 5e-40)

                      Complete

                      ER2

                      Ubiquitinyl hydrolase 4 ETH_00007310 on Supercontig_39

                      CA

                      C19

                      Cryptosporidium muris RN66 gcontig_1106632353835 (E=1e-60)

                      PDB: Usp14, A Proteasome-Associated Deubiquitinating Enzyme (E= 5e-40)

                      Complete (disrupted)

                      ER2

                      Ubiquitinyl hydrolase 5 ETH_00003260 on Supercontig_106

                      CA

                      C19

                      Plasmodium falciparum VS/1 cont1.2577 (E=2e-49)

                      PDB: Human Ubiquitin Carboxyl-Terminal Hydrolase 8 (E=2e-37)

                      Partial

                      ER2

                      Ubiquitinyl hydrolase 6 ETH_00020635 on Supercontig_5

                      CA

                      C19

                      Toxoplasma gondii GT1 gcontig_1107000919460 (E=1e-12)

                      Swiss-Prot: Ubiquitin carboxyl-terminal hydrolase 26 Arabidopsis thaliana (E= 2e-12)

                      Partial

                      ER2/3

                      Ubiquitinyl hydrolase 7 ETH_00008925 on Supercontig_8

                      CA

                      C19

                      Plasmodium vivax SaI-1 ctg_6569 (E=1e-30)

                      PDB: Ubiquitin-Usp2 Complex [human] (E= 2e-15)

                      Partial

                      ER2

                      Ubiquitinyl hydrolase 8 ETH_00003260 on Supercontig_106

                      CA

                      C19

                      Neospora caninum Liverpool Ubiquitin carboxyl-terminal hydrolase, related (NCLIV_024510) mRNA, complete cds (E=8e-17)

                      PDB: Covalent Ubiquitin-Usp2 Complex [human] (E= 4e-10)

                      Partial

                      ER2/3

                      OTU protease no gene name on NODE_10106_length_3351_cov_7.612056

                      CA

                      C88

                      Toxoplasma gondii ME49 gcontig_1112359861240 (E=3e-9)

                      PDB: OTU [Saccharomyces cerevisiae] (E= 2e-11)

                      None

                      ER3/4

                      Pyroglutamyl peptidase ETH_00030160 on Supercontig_14

                      CF

                      C15

                      Toxoplasma gondii ME49 gcontig_1112359873116 (E=0.1)

                      Swiss-Prot: Pyrrolidone Carboxyl Peptidase (pyroglutamyl peptidase) Chromobacterium violaceum (E= 8e-5)

                      Partial

                      ER3

                      Metallo Proteases

                            

                      Aminopeptidase N 1 ETH_00013105 on Supercontig_9

                      MA

                      M1

                      Neospora caninum Liverpool complete genome, chromosome X (E=1e-24)

                      PDB: Aminopeptidase N From Human Pathogen Neisseria meningitidis (E=1e-144)

                      Partial

                      ER2

                      Aminopeptidase N 2 ETH_00015595 on Supercontig_153

                      MA

                      M1

                      Babesia bovis strain T2Bo chromosome 4 gcontig_1104837696308 (E=7e-57)

                      PDB: M1 Alanylaminopeptidase From Malaria (E= 4e-65)

                      Partial

                      ER2

                      ATP-dependant Zn protease 1 no gene name on NODE_975_length_1397_cov_15.574087

                      MA

                      M41

                      Plasmodium falciparum FCC-2/Hainan cont1.4384 (E=9e-31)

                      PDB: Ftsh Protease Domain [Aquifex aeolicus] (E=1e-21)

                      Complete

                      ER2

                      ATP-dependant Zn protease 2 ETH_00018435 on Supercontig_60

                      MA

                      M41

                      Plasmodium falciparum VS/1 cont1.4464 (E=2e-68)

                      PDB: Ftsh [Escherichia coli] (E=1e-65)

                      Complete

                      ER2

                      ATP-dependant Zn protease 3 ETH_00010985 on Supercontig_4

                      MA

                      M41

                      Toxoplasma gondii ME49 gcontig_1112359860098 (E=2e-54)

                      PDB: Human Paraplegin (FtsH endopeptidase family) (E=7e-40)

                      Partial

                      ER3

                      CaaX prenyl protease ETH_00017305 on Supercontig_76

                      MA

                      M48

                      Babesia bovis strain T2Bo chromosome 4 gcontig_1104837696380 (E=2e-77)

                      Swiss-Prot: CAAX prenyl protease 1 homolog [Arabidopsis thaliana] (E=2e-83)

                      Complete

                      ER2

                      Insulysin 1 ETH_00011835 on Supercontig_36

                      ME

                      M16

                      Plasmodium vivax SaI-1 ctg_7222 (E=5e-168)

                      PDB: Bovine Bc1 (Zn-dependant insulinase) (E=1e-101)

                      Complete

                      ER2

                      Insulysin 2 ETH_00032950 on Supercontig_103

                      ME

                      M16

                      Babesia bovis T2Bo chromosome 3 (E=1e-133)

                      PDB: Yeast Mitochondrial Processing Peptidase (E=4e-60)

                      Complete

                      ER2

                      Insulysin 3 ETH_00001730 on Supercontig_54

                      ME

                      M16

                      Toxoplasma gondii ME49 gcontig_1112359871056 (E=3e-90)

                      PDB: Human insulin degrading enzyme (Ide) (E=2e-46)

                      Complete

                      ER1/2

                      Insulysin 4 no gene name on Supercontig_901

                      ME

                      M16

                      Toxoplasma gondii VEG gcontig_1104442817478 (E=1e-22)

                      PDB: Human insulin degrading enzyme (Ide) (E=3e-17)

                      Partial

                      ER2/3

                      Insulysin 5 no gene name on NODE_2627_length_1769_cov_14.530243

                      ME

                      M16

                      -

                      PDB: Pitrilysin (M16 family) [Escherichia coli O157:H7] (E=7e-05)

                      None

                      ER4

                      Leucine aminopeptidase ETH_00012380 on Supercontig_27

                      MF

                      M17

                      Toxoplasma gondii ME49 cytosol aminopeptidase, mRNA (E=4e-54)

                      PDB: E. coli Aminopeptidase A (Pepa) (E=1e-53)

                      Complete

                      ER2

                      O-sialoglycoprotease ETH_00020530 on Supercontig_5

                      MK

                      M22

                      Toxoplasma gondii ME49 glycoprotease family domain-containing protein, mRNA (E=1e-47)

                      PDB: Methanococcus jannaschii Kae1-Bud32 Fusion Protein (Kae1: sialoglycoprotease homologue) (E=1e-51)

                      Complete (disrupted)

                      ER2

                      S2P-like protease ETH_00009130 on Supercontig_80

                      MM

                      M50

                      -

                      NR: peptidase, M50 family protein [Toxoplasma gondii] (E=4e-21)

                      Complete

                      ER3

                      Serine Proteases

                            

                      Trypsin 1 ETH_00028355 on Supercontig_45

                      PA

                      S1

                      Babesia bovis strain T2Bo chromosome 4 gcontig_1104837696308 (E=1e-56)

                      Swiss-Prot: Protease Do-like 10 [Arabidopsis thaliana] (E=2e-63)

                      Complete

                      ER2

                      Trypsin 2 ETH_00012215 on Supercontig_27

                      PA

                      S1

                      Neospora caninum Liverpool complete genome, chromosome IX (E=1e-21)

                      Swiss-Prot: Protease Do-like 9 [Arabidopsis thaliana] (E=1e-63)

                      Complete

                      ER2/3

                      Trypsin 3 ETH_00015245 on Supercontig_30

                      PA

                      S1

                      Toxoplasma gondii ME49 gcontig_1112359861240 (E=6e-58)

                      Swiss-Prot: Protease Do-like 2 [Arabidopsis thaliana] (E=2e-80)

                      Complete

                      ER2

                      Subtilisin 1 ETH_00009790 on Supercontig_570

                      SB

                      S8

                      Cryptosporidium parvum Iowa II chromosome 6 chr6.s2 (E=2e-22)

                      Swiss-Prot: Cell wall-associated protease [Bacillus subtilis] (E=8e-18)

                      Partial

                      ER2

                      Subtilisin 2 ETH_00025145 on Supercontig_1463

                      SB

                      S8

                      Cryptosporidium muris RN66 gcontig_1106632353939 (E=8e-18)

                      Swiss-Prot: Major intracellular serine protease [Bacillus subtilis] (E=4e-9)

                      Partial

                      ER1/2

                      Subtilisin 3 ETH_00011050 on Supercontig_4

                      SB

                      S8

                      Cryptosporidium muris RN66 gcontig_1106632353939 (E=1e-39)

                      PDB: Subtilisin [Bacillus licheniformis] (E=3e-28)

                      Complete

                      ER2

                      Subtilisin 4 ETH_00006825 on Supercontig_65

                      SB

                      S8

                      Cryptosporidium parvum Iowa II chromosome 6 chr6.s2 (E=3e-53)

                      PDB: Thermitase [Thermoactinomyces vulgaris] (E=3e-32)

                      Complete

                      ER2

                      Subtilisin 5 ETH_00011340 on Supercontig_4

                      SB

                      S8

                      Toxoplasma gondii ME49 gcontig_1112359859078 (E=3e-24)

                      PDB: Thermostable Serine Protease [Bacillus sp] (E=8e-7)

                      Partial

                      ER3/4

                      Subtilisin 6 ETH_00016890 on Supercontig_22

                      SB

                      S8

                      Toxoplasma gondii VEG gcontig_1104442818966 (E=6e-34)

                      PDB: Thermitase [Thermoactinomyces vulgaris] (E= 4e-11)

                      Partial

                      ER3/4

                      Prolyl endopeptidase ETH_00028960 on Supercontig_1

                      SC

                      S33

                      Neospora caninum Liverpool complete genome, chromosome V (E=2e-6)

                      Swiss-Prot: prolyl endopeptidase [Mus musculus] (E=4e-98)

                      Complete

                      ER2

                      Clp protease ETH_00030480 on Supercontig_126

                      SK

                      S14

                      -

                      Swissprot: ATP-dependent Clp protease proteolytic subunit [Neisseria meningitidis] (E= 3e-11)

                      Partial

                      ER3/4

                      Rhomboid protease ETH_00020020 on Supercontig_2

                      ST

                      S54

                      Plasmodium falciparum Santa Lucia cont1.4986, (E=1e-23)

                      Swiss-Prot: Rhomboid-like protease 1 [Toxoplasma gondii] (E=3e-47)

                      Complete

                      ER1/2

                      The E. tenella genome database (http://​www.​genedb.​org/​Homepage/​Etenella) was searched for genes predicted to code for proteins with peptidase activity. All auto-annotated peptidase genes identified were manually curated by performing BLAST analysis against apicomplexan genome sequence databases and various protein databases [32] such as the protein data bank (PDB), Swiss-Prot and non-redundant (NR). In addition, signature protein motifs for the protein sequence of each gene were identified through Pfam (http://​pfam.​sanger.​ac.​uk/​search; [33]), InterproScan (http://​www.​ebi.​ac.​uk/​Tools/​pfa/​iprscan/​) and the MEROPS databases (http://​merops.​sanger.​ac.​uk/​; [34]). Further gene sequence manipulations, such as translation into amino acid sequences and ClustalW alignments, were performed using the DNASTAR Lasergene™ 9 Core Suite. Genes were assigned a five-tiered level of confidence for gene function using an Evidence Rating (ER) system giving an overall score of ER1-5, where ER1 indicates extremely reliable experimental data to support function and ER5 indicates no evidence for gene function [17].

                      Stage-specific protease gene expression

                      To assess the stage specific gene expression of putative proteases identified in the E. tenella database, different stages of the parasite lifecycle were isolated and total RNA purified. These stages included merozoites, 134 h gametocytes, unsporulated oocysts, sporulated oocysts as well as uninfected caeca control tissue. RT-PCR was performed and the stage-specific cDNA samples were subjected to control PCRs to determine purity (Figure 1). Purification of merozoite and gametocyte lifecycle stages inevitably results in co-purification of host tissue, hence, the E. tenella β-actin structural gene was amplified to optimize relative amounts of parasite starting material as described previously [18]. The E. tenella β-actin gene was amplified from each of the parasite lifecycle cDNA samples and quantification of bands visualized by agarose gel electrophoresis allowed the specific E. tenella cDNA to be standardized to each other accordingly. The E. tenella gam56 gene product, which is predominantly expressed in gametocytes but largely down-regulated in unsporulated oocysts, confirmed the quality of gametocyte cDNA and served as a gametocyte-specific positive control, establishing the lack of gametocytes in merozoite and oocyst samples. The amplification of the tfp250 gene, specifically expressed in the asexual stages [19], indicated contaminating merozoite cDNA in the gametocyte cDNA sample, as anticipated, at the 134 h time point. Furthermore, amplification of a chicken host-specific lysozyme gene indicated host cDNA was present in both merozoite and gametocyte preparations, also as anticipated.
                      http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-13-685/MediaObjects/12864_2012_4758_Fig1_HTML.jpg
                      Figure 1

                      RT-PCR assessment of purity of Eimeria tenella merozoites, gametocytes and oocysts. Total RNA was extracted from E. tenella merozoite (M), gametocyte (G), unsporulated oocyst (UO) and sporulated oocyst (SO) preparations. cDNA was synthesized and stage-specific parasite genes (GAM56 for gametocytes; TFP250 for merozoites and sporozoites) was amplified by RT-PCR. PCR samples were run alongside chicken host cDNA (H), E. tenella genomic DNA (gD) and a negative control sample with no template (−) on a 1% agarose gel. The E. tenella β-actin gene product was used to standardize loading of parasite cDNA samples.

                      After optimisation of parasite lifecycle stage cDNA samples, primer pairs were designed to generate PCR products from exons of less than 1 kb in size, where possible. PCRs were performed at optimal annealing temperatures specific for the individual primer pairs and annealing times optimal for predicted cDNA sized products. PCRs were performed at least twice (and normally three times) for each gene product, by different researchers each time. In the case of failed PCRs, primer pairs were redesigned and retested. Results of PCR on the different lifecycle stages of E. tenella indicated that 40 of the 45 protease genes could be amplified from parasite cDNA (Table 2). The five PCRs that failed to amplify a product from cDNA were for three of the eight ubiquitinyl hydrolases, the single OTU protease and one of the six subtilisins. However, it was possible to amplify PCR products from gDNA for all five of these proteases that, when sequenced, confirmed primer specificity (data not shown). The failure to amplify a product from cDNA for these genes may be due to genome annotation problems; possibly the sequence targeted by our primers is not transcribed or falls in unpredicted intronic regions. Alternatively, a low abundance of these transcripts may have contributed to the failure to detect cDNA amplification products. Further work will be required to characterize these genes. All other PCR products from cDNA from the four E. tenella lifecycle stages were directly sequenced to confirm the correct coding sequence. Expected and actual cDNA amplicon sizes and their corresponding sequence accession numbers are shown in Table 2.
                      Table 2

                      Expression of protease genes in merozoites, gametocytes, unsporulated oocysts and sporulated oocysts of Eimeria tenella

                      Protease group

                      cDNA product

                      Stage specific expression

                      Predicted amplicon size

                      Actual amplicon size

                      Genbank accession number

                      Aspartic Proteases

                      M G UO SO

                       

                      (bp)

                      (bp)

                       

                      Eimepsin 1

                      http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-13-685/MediaObjects/12864_2012_4758_Equa_HTML.gif

                      Oocyst Specific

                      357

                      659

                      AJ293829

                      Eimepsin 2

                      http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-13-685/MediaObjects/12864_2012_4758_Equb_HTML.gif

                      Gametocyte Specific

                      467

                      467

                      JX503496

                      Eimepsin 3

                      http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-13-685/MediaObjects/12864_2012_4758_Equc_HTML.gif

                      Merozoite Upregulated

                      578

                      578

                      JX503497

                      Cysteine proteases

                      http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-13-685/MediaObjects/12864_2012_4758_Equd_HTML.gif

                          

                      Cathepsin B

                      http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-13-685/MediaObjects/12864_2012_4758_Eque_HTML.gif

                      Downregulated in Sporulated Oocyst

                      656

                      656

                      JN641867.1

                      Cathepsin L

                      http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-13-685/MediaObjects/12864_2012_4758_Equf_HTML.gif

                      Downregulated in Gametocytes

                      330

                      300

                      JX503498

                      Cathepsin C1

                      http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-13-685/MediaObjects/12864_2012_4758_Equg_HTML.gif

                      Merozoite Upregulated

                      547

                      547

                      JX503499

                      Cathepsin C2

                      http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-13-685/MediaObjects/12864_2012_4758_Equh_HTML.gif

                      Gametocyte Upregulated

                      273

                      273

                      JX503500

                      Cathepsin C3

                      http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-13-685/MediaObjects/12864_2012_4758_Equi_HTML.gif

                      Gametocyte and Unsporulated Oocyst Upregulated

                      436

                      436

                      JX546580

                      Calpain

                      http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-13-685/MediaObjects/12864_2012_4758_Equj_HTML.gif

                      Merozoite Upregulated

                      831

                      806

                      JX503501

                      Ubiquitinyl hydrolase 1

                      http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-13-685/MediaObjects/12864_2012_4758_Equk_HTML.gif

                      Merozoite Upregulated

                      548

                      548

                      JX503503

                      Ubiquitinyl hydrolase 2

                      http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-13-685/MediaObjects/12864_2012_4758_Equl_HTML.gif

                      Gametocyte Upregulated

                      395

                      395

                      JX503504

                      Ubiquitinyl hydrolase 3

                      http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-13-685/MediaObjects/12864_2012_4758_Equm_HTML.gif

                      Merozoite, possibly Gametocyte Upregulated

                      698

                      698

                      JX503505

                      Ubiquitinyl hydrolase 4

                      http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-13-685/MediaObjects/12864_2012_4758_Equn_HTML.gif

                      Merozoite Upregulated

                      499

                      499

                      JX503506

                      Ubiquitinyl hydrolase 5

                      http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-13-685/MediaObjects/12864_2012_4758_Equo_HTML.gif

                      Gametocyte Upregulated

                      674

                      719

                      JX503507

                      Ubiquitinyl hydrolase 6

                      http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-13-685/MediaObjects/12864_2012_4758_Equp_HTML.gif

                      -

                      546

                      -

                      -

                      Ubiquitinyl hydrolase 7

                      http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-13-685/MediaObjects/12864_2012_4758_Equq_HTML.gif

                      -

                      529

                      -

                      -

                      Ubiquitinyl hydrolase 8

                      http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-13-685/MediaObjects/12864_2012_4758_Equr_HTML.gif

                      -

                      303

                      -

                      -

                      OTU protease

                      http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-13-685/MediaObjects/12864_2012_4758_Equs_HTML.gif

                      -

                      802

                      -

                      -

                      Pyroglutamyl peptidase

                      http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-13-685/MediaObjects/12864_2012_4758_Equt_HTML.gif

                      Gametocyte Upregulated

                      735

                      771

                      JX503502

                      Metalloproteases

                           

                      Aminopeptidase N 1

                      http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-13-685/MediaObjects/12864_2012_4758_Equu_HTML.gif

                      Downregulated in Merozoite

                      602

                      602

                      JX503508

                      Aminopeptidase N 2

                      http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-13-685/MediaObjects/12864_2012_4758_Equv_HTML.gif

                      Gametocyte Upregulated

                      636

                      636

                      JX503509

                      ATP-dependant Zn protease 1

                      http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-13-685/MediaObjects/12864_2012_4758_Equw_HTML.gif

                      Downregulated in Sporulated Oocyst

                      604

                      604

                      XM_001238661.1

                      ATP-dependant Zn protease 2

                      http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-13-685/MediaObjects/12864_2012_4758_Equx_HTML.gif

                      Merozoite Upregulated

                      389

                      389

                      JX503516

                      ATP-dependant Zn protease 3

                      http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-13-685/MediaObjects/12864_2012_4758_Equy_HTML.gif

                      Downregulated in Sporulated Oocyst

                      567

                      1045

                      JX503517

                      CAAX prenyl protease

                      http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-13-685/MediaObjects/12864_2012_4758_Equz_HTML.gif

                      Merozoite Upregulated

                      368

                      368

                      JX503518

                      Insulysin 1

                      http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-13-685/MediaObjects/12864_2012_4758_Equaa_HTML.gif

                      Merozoite Upregulated

                      294

                      294

                      JX503510

                      Insulysin 2

                      http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-13-685/MediaObjects/12864_2012_4758_Equab_HTML.gif

                      Merozoite Upregulated

                      416

                      416

                      JX503511

                      Insulysin 3

                      http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-13-685/MediaObjects/12864_2012_4758_Equac_HTML.gif

                      Oocyst Specific

                      402

                      697

                      JX503512

                      Insulysin 4

                      http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-13-685/MediaObjects/12864_2012_4758_Equad_HTML.gif

                      Gametocyte Upregulated

                      367

                      367

                      JX503513

                      Insulysin 5

                      http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-13-685/MediaObjects/12864_2012_4758_Equae_HTML.gif

                      Merozoite Upregulated

                      202

                      202

                      *

                      Leucyl aminopeptidase

                      http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-13-685/MediaObjects/12864_2012_4758_Equaf_HTML.gif

                      Merozoite, possibly Gametocyte Upregulated

                      804

                      859

                      JX503514

                      O-sialoglycoprotease

                      http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-13-685/MediaObjects/12864_2012_4758_Equag_HTML.gif

                      Merozoite Upregulated

                      412

                      412

                      JX503515

                      S2P-like protease

                      http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-13-685/MediaObjects/12864_2012_4758_Equah_HTML.gif

                      Gametocyte Specific

                      616

                      1027

                      JX503519

                      Serine proteases

                           

                      Trypsin 1

                      http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-13-685/MediaObjects/12864_2012_4758_Equai_HTML.gif

                      Gametocyte Specific

                      613

                      613

                      JX503520

                      Trypsin 2

                      http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-13-685/MediaObjects/12864_2012_4758_Equai_HTML.gif

                      Gametocyte Upregulated

                      721

                      721

                      JX503521

                      Trypsin 3

                      http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-13-685/MediaObjects/12864_2012_4758_Equaj_HTML.gif

                      Merozoite Upregulated

                      654

                      849

                      JN987371.1

                      Subtilisin 1

                      http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-13-685/MediaObjects/12864_2012_4758_Equak_HTML.gif

                      Gametocyte Specific

                      260

                      260

                      XM_001238722.1

                      Subtilisin 2

                      http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-13-685/MediaObjects/12864_2012_4758_Equal_HTML.gif

                      Gametocyte Specific

                      690

                      690

                      XM_001238654.1

                      Subtilisin 3

                      http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-13-685/MediaObjects/12864_2012_4758_Equam_HTML.gif

                      Merozoite Upregulated

                      1171

                      1084

                      JX503522

                      Subtilisin 4

                      http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-13-685/MediaObjects/12864_2012_4758_Equan_HTML.gif

                      Gametocyte and Unsporulated Oocyst Upregulated

                      566

                      566

                      JX503523

                      Subtilisin 5

                      http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-13-685/MediaObjects/12864_2012_4758_Equao_HTML.gif

                      Gametocyte Specific

                      360

                      414

                      JX503524

                      Subtilisin 6

                      http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-13-685/MediaObjects/12864_2012_4758_Equap_HTML.gif

                      -

                      365

                      -

                      -

                      Prolyl endopeptidase

                      http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-13-685/MediaObjects/12864_2012_4758_Equaq_HTML.gif

                      Downregulated in Sporulated Oocyst

                      534

                      534

                      JX503526

                      Clp protease

                      http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-13-685/MediaObjects/12864_2012_4758_Equar_HTML.gif

                      Merozoite Upregulated

                      413

                      241

                      JX503525

                      Rhomboid protease 1

                      http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-13-685/MediaObjects/12864_2012_4758_Equas_HTML.gif

                      Merozoite Upregulated

                      554

                      554

                      JN987619.1

                      M Merozoites, G Gametocytes, UO Unsporulated Oocysts, SO Sporulated Oocysts.

                      * = short sequence not accepted for submission.

                      The majority of the protease genes were expressed in more than one of the four parasite stages investigated (Table 2). However, stage-specific up- or downregulation of protease gene expression was evident. Thus, taking into account that merozoite cDNA contaminates the gametocyte samples, it is safe to conclude that there were a large number (at least 15, probably 17) of protease genes whose expression was upregulated in merozoites including eimepsin 3, cathepsin C1, calpain, several of the ubiquitinyl hydrolases, an ATP-dependent Zn protease, the CAAX prenyl protease, three of the five insulysins, the leucyl aminopeptidase, the O-sialoglycoprotease, one of the trypsins, a subtilisin, the Clp protease and rhomboid protease 1. Aminopeptidase N1 appeared to be downregulated specifically in merozoites. Gametocyte-specific or gametocyte-upregulated proteases were also common, with thirteen in all, also distributed across the four groups of proteases, including eimepsin 2, cathepsin C2, ubiquitinyl hydrolase 2 and 5, the pyroglutamyl peptidase, aminopeptidase N2, insulysin 4, the S2P-like metalloprotease, two trypsin-like proteases and three of the subtilisins. Additionally, two other proteases were upregulated or specific for the sexual phase of the lifecycle (i.e., gametocytes and unsporulated oocysts), namely, cathepsin C3 and subtilisin 4. Cathepsin L appeared to be downregulated specifically in gametocytes. Only two protease genes, a pepsin-like protease with high homology to eimepsin (eimepsin 1) and an insulysin, were switched on exclusively in oocyst lifecycle stages. In contrast, numerous protease genes appeared to be downregulated in sporulated oocysts (Table 2).

                      Protease processing of GAM56

                      Gametocytes from E. tenella-infected caeca were lysed and immediately incubated with or without protease inhibitors for various lengths of time, and the native GAM56 protein analysed by SDS-PAGE and western blotting with anti-GAM56 antibodies, as described previously [20, 21], to track the disappearance of the protein to determine whether any inhibitors could prevent the degradation observed in the presence of native gametocyte proteases. The precise epitopes recognised by the anti-GAM56 polyclonal antibodies are not known for E. tenella though there is some evidence, from work with E. maxima[21], that they are located in the conserved amino-terminus of the protein. The anti-GAM56 antibodies are, thus, very useful for sensitive and specific tracking of the degradation of GAM56. No disappearance of GAM56 was apparent after 2, 4, 6, 8, 10, 12 or 16 h (data not shown) but was obvious at 24h (Figure 2). The 24 h assay was therefore repeated three times with a comprehensive range of protease inhibitors (Table 3) targeting the four protease families identified in the genome. The aspartyl protease inhibitor, pepstatin A, had no effect on GAM56 disappearance (Figure 2). None of three cysteine protease inhibitors investigated, Z-Phe-Ala-diazomethylketone (data not shown), N-ethylmalemide (data not shown) or E64 (Figure 2) inhibited GAM56 disappearance. The serine/cysteine protease inhibitor, chymostatin (data not shown) and leupeptin (Figure 2), inhibited GAM56 disappearance but another inhibitor with the same specificity, antipain, did not (data not shown). The serine protease specific inhibitors, benzamidine HCL (data not shown), soybean trypsin inhibitor (data not shown) and aprotinin (Figure 2) all inhibited the disappearance of GAM56 but AEBSF did not (Figure 2). The metal chelating agent, EDTA, also inhibited the disappearance of GAM56 but more specific metalloprotease inhibitors, bestatin and phosphoramidon, did not (Figure 2).
                      http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-13-685/MediaObjects/12864_2012_4758_Fig2_HTML.jpg
                      Figure 2

                      The effect of protease inhibitors on degradation of GAM56 in Eimeria tenella gametocytes. A sample of purified E. tenella gametocytes was lysed and equal volumes of lysate added to a range of protease inhibitors (see Table 3 for details on concentrations and specificity) or PBS. A zero time point sample was taken immediately. Other samples were incubated for 24 h at 37°C, after which the assay was halted by addition to Laemmli buffer and the samples subjected to SDS-PAGE and immunoblotting as described previously [20, 21] to assess the disappearance of GAM56. Lane 1, time = zero sample; Lane 2, pepstatin A; Lane 3, E64; Lane 4, aprotonin; Lane 5, AEBSF; Lane 6, bestatin; Lane 7, leupeptin; Lane 8, phosphoramidon; Lane 9, EDTA; Lane 10, a cocktail of pepstatin A, E64, aprotonin, AEBSF, bestatin, leupeptin, phosphoramidon and EDTA; Lane 11, control sample containing no protease inhibitors.

                      Table 3

                      Protease inhibitors used in the Eimeria tenella GAM56 processing assay

                      Inhibitor

                      Inhibitor target

                      Final concentration

                      Company

                      Pepstatin A

                      Aspartyl

                      1 μm

                      Sigma-Aldrich

                      N-ethylmalemide

                      Cysteine

                      1 mM

                      Sigma-Aldrich

                      E-64

                      Cysteine

                      10 μM

                      MP Biomedicals

                      Z-Phe-Ala-diazomethylketone

                      Cysteine

                      2 μM

                      Bachem, UK

                      Antipain

                      Ser + Cys

                      100 μM

                      MP Biomedicals

                      Chymostatin

                      Ser + Cys

                      200 μg/ml

                      Sigma-Aldrich

                      Leupeptin

                      Ser + Cys

                      100 μM

                      Sigma-Aldrich

                      AEBSF

                      Serine

                      1 mM

                      Sigma-Aldrich

                      Aprotinin

                      Serine

                      0.002 TIU

                      MP Biomedicals

                      Benzamidine HCl

                      Serine

                      4 mM

                      Sigma-Aldrich

                      Soybean Trypsin inhibitor

                      Serine

                      100 μg/ml

                      Sigma-Aldrich

                      Bestatin

                      Metallo (amino)

                      40 μM

                      Sigma-Aldrich

                      Phosphoramidon

                      Metallo (endo)

                      10 μM

                      MP Biomedicals

                      EDTA di-sodium salt

                      Metallo

                      5 mM

                      Sigma-Aldrich

                      Discussion

                      Mining of the E. tenella genome database has revealed over 40 protease transcripts distributed over 13 clans and 18 families of aspartic, cysteine, metallo and serine proteases. Such diversity of proteases is not unusual, indeed it may be an underestimate of the true number of protease genes in this parasite since other apicomplexan parasites are known to possess substantially more protease genes (Table 4); thus, for example, there are at least 70 in Cryposporidium parvum, more than 80 in P. falciparum and over 90 in T. gondii, though other apicomplexan parasites possess similar numbers of protease genes as E. tenella. Eimeria tenella also has lower numbers of protease genes than protozoan parasites like Leishmania, Trypanosoma and Trichomonas (though the latter is known to have an unusually expanded genome in general [22] and, apparently, in C1 and C19 cysteine proteases and M8 metalloproteases, in particular; Table 4). But, again, E. tenella has a broadly similar total number of protease genes to Entamoeba dispar and Giardia intestinalis, which are also intestinal parasites. However, the fact that our dataset for E. tenella lacks protease genes for several families, across all four types of proteases, that are represented in all other Apicomplexa and most other protozoan parasites, including A28, A22, C12, C85, C86, C13, C14, C50, C48, M24, M18, M67, S9, S26 and S16, provides reason to believe that some E. tenella protease genes remain unannotated.
                      Table 4

                      Distribution of protease clans and families in Eimeria tenella , its host and other protozoan parasites

                      Clan

                      Family

                      G.g

                      E.t

                      T.g

                      C.p

                      C.h

                      C.m

                      P.f

                      P.v

                      P.b

                      P.c

                      P.y

                      T.a

                      T.p

                      E.d

                      L.b

                      L.i

                      L.m

                      T.b

                      T.c

                      T.v

                      G.i

                      AA

                      A1

                      11

                      3

                      8

                      4

                      3

                      6

                      11

                      6

                      5

                      3

                      9

                      4

                      3

                            

                      1

                       

                      A2

                      3

                                          

                      A28

                      1

                       

                      1

                      2

                      1

                      1

                      1

                      1

                      1

                      1

                      2

                      1

                       

                      1

                      1

                      1

                      1

                      1

                      1

                      2

                      6

                      AD

                      A22

                      6

                       

                      1

                      1

                      1

                      1

                      1

                      1

                      1

                       

                      1

                        

                      4

                      2

                      2

                      2

                      2

                      2

                      4

                      2

                      CA

                      C1

                      12

                      5

                      4

                      5

                      4

                      4

                      10

                      9

                      8

                      4

                      8

                      12

                      10

                      15

                      3

                      4

                      3

                      2

                      7

                      42

                      21

                      C2

                      12

                      1

                      2

                      1

                       

                      1

                      2

                      1

                      2

                      2

                      1

                      1

                       

                      1

                      2

                      2

                      2

                      1

                      2

                      4

                       

                      C12

                      4

                       

                      2

                      2

                      2

                      1

                      2

                      1

                        

                      2

                        

                      2

                      2

                      1

                      2

                      2

                      2

                      1

                       

                      C19

                      30

                      8

                      1

                      7

                      3

                      2

                      7

                      1

                      2

                      3

                      4

                      5

                      1

                      1

                      3

                      1

                      9

                      8

                      3

                      68

                      4

                      C51

                                    

                      1

                      1

                      2

                      3

                      2

                        

                      C54

                      3

                        

                      1

                       

                      1

                      1

                            

                      4

                      2

                      2

                      2

                      2

                      2

                      5

                       

                      C64

                      4

                                          

                      C65

                        

                      1

                                 

                      1

                      1

                      1

                      1

                      1

                        

                      C66

                                         

                      1

                       

                      C67

                      2

                                          

                      C78

                      1

                       

                      1

                      1

                       

                      1

                           

                      1

                      1

                       

                      1

                      1

                      1

                      1

                      1

                        

                      C85

                      2

                       

                      1

                      1

                      1

                      2

                      1

                      1

                        

                      1

                                

                      C86

                      2

                       

                      1

                      1

                      1

                      1

                      1

                      1

                      1

                       

                      1

                                

                      C88

                      1

                      1

                      1

                                

                      1

                      1

                      1

                      1

                      1

                      1

                      1

                       

                      CD

                      C11

                        

                      1

                      1

                       

                      1

                                     

                      C13

                      2

                       

                      1

                      2

                      1

                      1

                      1

                      1

                        

                      1

                      1

                      1

                      1

                      1

                      1

                      1

                      1

                      1

                      9

                      2

                      C14

                      12

                       

                      2

                      1

                      1

                      1

                      1

                       

                      1

                      1

                          

                      1

                      1

                      1

                      2

                      2

                      6

                       

                      C50

                        

                      1

                      1

                      1

                      1

                             

                      1

                       

                      1

                      1

                      1

                      1

                      1

                      1

                      CE

                      C48

                      6

                       

                      3

                      2

                      1

                      1

                      1

                      1

                      1

                      2

                      2

                      2

                      2

                      1

                         

                      1

                      1

                      6

                       

                      CF

                      C15

                      2

                      1

                      1

                                    

                      1

                      1

                      1

                       

                      CO

                      C40

                                         

                      6

                       

                      M-

                      M49

                                   

                      1

                      1

                      1

                      1

                        

                      1

                      2

                      M76

                      1

                       

                      3

                         

                      1

                      1

                      1

                      1

                      1

                         

                      1

                      1

                      1

                      1

                      2

                        

                      M79

                            

                      1

                       

                      1

                      1

                       

                      1

                           

                      1

                      2

                      1

                      1

                      MA

                      M1

                      10

                      2

                      3

                      1

                      1

                      1

                      1

                       

                      1

                      1

                      1

                      1

                      1

                      1

                      2

                      2

                      4

                      2

                      3

                      3

                       

                      M2

                      3

                                          

                      M3

                      3

                       

                      3

                         

                      2

                      2

                      2

                      2

                      3

                       

                      1

                      2

                      3

                      3

                      4

                      2

                      3

                      1

                       

                      M8

                      1

                                  

                      1

                      24

                      8

                      4

                      9

                      76

                      42

                       

                      M10

                      16

                                          

                      M12

                      35

                                          

                      M13

                      8

                       

                      1

                                        

                      M32

                                    

                      2

                      3

                      4

                      1

                      2

                        

                      M41

                      1

                      3

                      3

                      1

                       

                      1

                      3

                      3

                      3

                      3

                      4

                      3

                      3

                       

                      1

                      5

                      5

                      5

                      5

                      1

                       

                      M43

                      2

                                          

                      M48

                      1

                      1

                      1

                      1

                      1

                      1

                           

                      1

                      1

                      1

                      1

                      1

                      1

                      1

                      1

                      4

                       

                      M54

                      1

                        

                      1

                      1

                      1

                                     

                      M80

                            

                      1

                      1

                      1

                           

                      1

                      1

                      1

                      1

                      1

                        

                      MC

                      M14

                      14

                        

                      1

                      1

                      1

                      1

                             

                      2

                       

                      2

                      3

                      3

                      3

                      4

                      ME

                      M16

                      12

                      5

                      7

                      8

                      4

                      4

                      4

                      3

                      4

                      1

                      4

                      5

                      4

                      2

                      2

                      3

                      3

                      3

                      3

                      7

                      3

                      MF

                      M17

                      3

                      1

                      1

                      1

                      1

                      1

                      1

                      1

                      1

                      3

                      2

                      1

                      1

                       

                      3

                      3

                      3

                      3

                      3

                        

                      MG

                      M24

                      6

                       

                      3

                      2

                      3

                      2

                      5

                      4

                      4

                      3

                      5

                      4

                      4

                      3

                      3

                      3

                      4

                      4

                      4

                      8

                      3

                      MH

                      M18

                      1

                       

                      1

                      1

                      1

                      1

                      1

                      1

                      1

                      1

                      1

                      1

                      1

                      1

                      1

                      1

                      1

                      1

                      1

                      5

                       

                      M20

                      4

                       

                      1

                        

                      1

                             

                      6

                      3

                      4

                      7

                      4

                      8

                      10

                      3

                      M28

                      10

                                     

                      1

                        

                      1

                       

                      MJ

                      M19

                      1

                                          

                      M38

                      4

                                          

                      MK

                      M22

                      2

                      1

                      1

                      1

                      1

                      1

                      2

                      1

                      1

                      1

                      2

                      2

                      1

                      1

                      1

                      1

                      1

                      1

                      1

                      1

                      2

                      MM

                      M50

                      1

                      1

                          

                      1

                                    

                      MP

                      M67

                      7

                       

                      2

                      2

                      2

                      1

                      1

                      1

                      1

                      1

                      1

                      2

                      2

                      2

                      2

                      2

                      3

                      1

                      3

                      4

                      2

                      PA

                      S1

                      66

                      3

                      4

                         

                      1

                      2

                         

                      1

                               

                      SB

                      S8

                      10

                      6

                      11

                      1

                       

                      1

                      3

                      3

                      2

                      2

                      2

                           

                      1

                      2

                      2

                      11

                       

                      SC

                      S9

                      15

                       

                      4

                      10

                      3

                      2

                      3

                      1

                      1

                       

                      2

                      2

                      1

                      2

                      5

                      4

                      7

                      8

                      8

                      8

                      5

                      S10

                      2

                                   

                      1

                      1

                      1

                      3

                      1

                        

                      S15

                      1

                       

                      1

                       

                      1

                                 

                      1

                       

                      1

                        

                      S28

                      1

                       

                      1

                                

                      2

                          

                      1

                      8

                      2

                      S33

                      3

                      1

                      2

                      3

                      1

                       

                      6

                      1

                      1

                      4

                      1

                        

                      1

                      2

                      1

                      2

                      1

                      2

                      13

                      7

                      SE

                      S12

                                         

                      1

                       

                      SF

                      S26

                      4

                       

                      1

                      1

                       

                      1

                      1

                      1

                      1

                      1

                       

                      2

                      2

                      1

                       

                      2

                      2

                      2

                      2

                      1

                      3

                      SJ

                      S16

                      2

                       

                      1

                        

                      1

                      1

                      1

                      1

                       

                      1

                      1

                      1

                              

                      SK

                      S14

                       

                      1

                          

                      1

                      1

                      1

                      1

                      1

                      2

                      1

                              

                      S41

                      1

                                          

                      SP

                      S59

                      1

                       

                      1

                      1

                       

                      1

                                     

                      SR

                      S60

                      1

                                          

                      ST

                      S54

                      6

                      1

                      6

                      3

                      2

                      3

                      7

                      2

                      4

                      2

                      5

                      1

                      1

                      1

                           

                      2

                       

                      Clan

                      Family

                      G.g

                      E.t

                      T.g

                      C.p

                      C.h

                      C.m

                      P.f

                      P.v

                      P.b

                      P.c

                      P.y

                      T.a

                      T.p

                      E.d

                      L.b

                      L.i

                      L.m

                      T.b

                      T.c

                      T.v

                      G.i

                      The distribution of families within clans of aspartic (AA, AD), cysteine (CA, CD, CE, CF, CO), metallo (M-, MA, MC, ME, MF, MG, MH, MJ, MK, MM, MP) and serine (PA, SB, SC, SE, SF, SJ, SK, SP, SR, ST) proteases of Eimeria tenella is compared with its host (Gallus gallus, the chicken) and other protozoan parasites from the MEROPs database of peptidases in whole genome sequences (merops.sanger.ac.uk/cgi-bin/compgen_index?type=P; [34]). Sequences for non-peptidase homologs are not included in the table. G.g = Gallus gallus; E.t = Eimeria tenella; T.g = Toxoplasma gondii; C.P. = Cryptosporidium parvum; C.h = Cryptosporidium hominis; C.m = Cryptosporidium muris; P.f = Plasmodium falciparum; P.v = Plasmodium vivax; P.b = Plasmodium berghei; P.c = Plasmodium chabaudi; P.y = Plasmodium yoelii; T.a = Theileria parva; P.a = Theileria annulata; E.d = Entamoeba dispar; L.b = Leishmania braziliensis; L.i = Leishmania infantum; L.m = Leishmania major; T. b = Trypanosoma brucei; T.c = Trypanosoma cruzi; T. v = Trichomona vaginalis; G.i = Giardia intestinalis.

                      The apparent stage-specific regulation of protease genes in E. tenella is striking and intriguing. Most investigations of parasitic protozoan proteases have focused on the asexual stages of the apicomplexan parasites, T. gondii and P. falciparum, establishing crucial roles for proteases in host cell invasion, remodelling and egress by the asexual stages of these parasites [1]. Our finding that expression of up to 17 of 40 protease genes examined in E. tenella is upregulated in merozoites further underscores the importance of proteases in the biology of the asexual stages of apicomplexan parasites. Not surprisingly, therefore, an eimepsin, several cathepsins, a calpain, a trypsin-like protease, subtilisins, Clp and a rhomboid protease are upregulated in the asexual stages of E. tenella (Table 2). Likewise, eimepsin1 and insulysin 3 are expressed specifically in oocysts and may play an important role in the first steps of the parasite lifecycle, such as host cell invasion; they are, therefore, worthy of further research. The downregulation of several proteases (including cathepsin B, ATP-depenedent ZN proteases 1 and 3, and a prolyl endopeptidase) in sporulated oocysts may be, in part, attributed to the dormancy of this lifecycle stage, yet still warrants further investigation.

                      Perhaps the most significant finding of our stage-specific expression study was the relatively large number of protease genes whose expression is upregulated specifically in the gametocytes stage – a total of at least 13 genes, including six that are only expressed in gametocyte (Table 2). This observation becomes even more intriguing when examined in the context of the distribution of different families of proteases across parasitic protozoa (Table 4). Four classes of proteases stand out amongst the protozoa because they are only found, or are “over-represented” in the two Coccidian parasites, E. tenella and T. gondii – families C15, M50, S1 and S8. Eimeria tenella contains a total of eleven protease genes distributed unevenly across these families, with only one in C15 and M50 and three and six in the serine protease families, S1 and S8, respectively. But, even more significantly, all but three of these unique protease genes are upregulated or confined in expression to the gametocyte stage of the parasite. Thus, expression of a pyroglutamyl peptidase, a trypsin-like protease and subtilisin 4 is upregulated in gametocytes whilst expression of an SP2-like protease, a trypsin 1-like protease and three subtilisins is entirely gametocyte specific.

                      One of the defining features of the Coccidia is the possession of a hard-walled oocyst that originates from specialized organelles (wall forming bodies) in macrogametocytes. It is hypothesized [16] that degradation of two proteins found in the wall forming bodies of macrogametocytes of Eimeria, namely GAM56 and GAM82, is integral to oocyst wall formation; tyrosine-rich peptides formed by the degradation of these two proteins are believed to be subsequently cross-linked via dityrosine bonds [23], giving the oocyst wall its renowned strength and resistance to environmental and chemical insults [24]. To test this hypothesis, we designed an assay to follow the degradation of GAM56 in freshly harvested gametocytes (Figure 2). This assay has certain inherent limitations: first, it relies on sensitive antibodies for detection of specific degradation of GAM56 and, unfortunately, the lack of suitable antibodies for detection of GAM82 in E. tenella[21] meant that we were unable to run confirmatory experiments with this protein; and, second, the only controls possible are a zero time point and a cocktail of protease inhibitors designed to prevent all proteolytic activity. These limitations require us to be cautious in our interpretations; none-the-less, the inhibition of degradation of native GAM56 by a very specific group of protease inhibitors reveals that this function may be carried out by subtilisin-like proteases. Thus, degradation of GAM56 was inhibited by the serine/cysteine protease inhibitors, chymostatin and leupeptin, and the serine protease specific inhibitors, benzamidine HCL, soybean trypsin inhibitor and aprotinin but not by AEBSF (Figure 2). Intriguingly, the metal chelating agent, EDTA, also inhibited degradation of GAM56. This profile indicates that serine proteases are critical for degradation of GAM56 but it seems to rule out participation of rhomboid proteases, which are unaffected by EDTA, aprotonin, leupeptin and chymostatin [25]. Trypsin-like proteases can, perhaps, not be completely ruled out of this process but the inhibitory profile, particularly the lack of inhibition by AEBSF coupled with the inhibitory effect of EDTA, points to a subtilisin or subtilisins as P. falciparum subtilisin 1 is inhibited in exactly the same fashion [26].

                      Subtilisins are further implicated in the formation of the oocyst wall of Eimeria through analogy with their known role in the formation of the cuticle of nematodes. Thus, the assembly of collagens to form the cuticle involves a number of molecular events that strikingly resemble our model of oocyst wall formation pathways: first, collagens are the result of degradation of proproteins by a subtilisin-like protease [2730]; and, second, these collagens are subsequently bonded together by di- and tri-tyrosine crosslinks [31]. A failure in either of these steps, results in a malformed cuticle and parasite death [31]. Subtilisins are currently being further investigated as potential candidates in the catalytic cleavage of the oocyst wall precursor proteins.

                      Conclusion

                      Eimeria tenella possesses a large number of genes coding for proteolytic enzymes, which display a remarkable pattern of stage specific expression. As in other apicomplexan parasites such as P. falciparum and T. gondii, expression of many of these genes is upregulated in the asexual, invasive stages, possibly indicating important roles in host cell invasion, remodelling and egress. However, expression of almost one-third of the protease genes identified in the E. tenella genome is upregulated or confined to the sexual gametocyte stage of this parasite’s lifecycle; some of these appear to be unique to Coccidia and may play key roles in the formation of the resilient oocyst wall, a defining feature of this group of important parasites.

                      Methods

                      Data-base mining

                      Eimeria tenella genome sequences and gene models were downloaded from GeneDB (http://​www.​genedb.​org/​Homepage/​Etenella). The genome of E. tenella (Houghton strain) was produced by the Parasite Genomics Group at the Wellcome Trust Sanger Institute (http://​www.​sanger.​ac.​uk/​research/​projects/​parasitegenomics​/​) and has been provided prepublication. The E. tenella genome database was searched for genes predicted to code for proteins with peptidase activity. All auto-annotated peptidase genes identified were manually curated by performing BLAST analysis against apicomplexan genome sequence databases and against various protein databases [32] such as the protein data bank (PDB), Swiss-Prot and non-redundant (NR) protein sequence databases. In addition, signature protein motifs for the protein sequence of each gene were identified through Pfam (http://​pfam.​sanger.​ac.​uk/​search; [33]), InterproScan (http://​www.​ebi.​ac.​uk/​Tools/​pfa/​iprscan/​) and the MEROPS databases (http://​merops.​sanger.​ac.​uk/​; [34]). Further gene sequence manipulations, such as translation into amino acid sequences and ClustalW alignments, were performed using the DNASTAR Lasergene™ 9 Core Suite. After the bioinformatic information was collated, genes were assigned a five-tiered level of confidence for gene function using an Evidence Rating (ER) system giving an overall score of ER1-5, where ER1 indicates extremely reliable experimental data to support function and ER5 indicates no evidence for gene function [17].

                      Animals and parasites

                      One day old chicks (Australorp; Barter and Sons Hatchery, Luddenham, Australia) were housed at the Ernst Facility Animal House (University of Technology, Sydney), under heat lamps for the first 2 weeks of their life and, thereafter, at 21°C with a 12 hour light/dark cycle with free access to food and water. Chickens were infected orally at 4.5 weeks of age with 2.5 × 103 sporulated oocysts of Eimeria tenella (Houghton strain originally provided by Janene Bumstead, Institute for Animal Health, Compton, UK). Fresh E. tenella oocysts were harvested 7 days post infection from the caeca following protocols published previously [35]. Sporulation of oocysts was carried out at 28°C for 72–120 hours using a low-pressure aquarium pump to aerate the suspension. Sporulated oocysts were then treated with 2.8 M NaCl and 2% sodium hypochlorite (Milton solution) and stored in 2% potassium dichromate at 4°C until required. Unsporulated oocysts were also treated with Milton solution and stored at −80°C. Merozoites (112 h p.i.) and gametocytes (134 h p.i.) were isolated from infected chicken caecae following techniques published previously [36, 37]. Aliquots of parasites were either frozen at −80°C as pellets or were stored in TRIzol® reagent (Invitrogen) at −80°C for further use in RNA purification.

                      RNA purification, cDNA synthesis and cDNA standardisation

                      To isolate total RNA, purified merozoites (1 × 107) and gametocytes (1 × 106) were resuspended in 1 ml TRIzol® Reagent and homogenized by pipetting. Unsporulated oocysts (2 × 105) and sporulated oocysts (5 × 105) were resuspended in 1 ml TRIzol® Reagent and one volume of glass beads were added to the sample, which were then vortexed for 1 min intervals until disruption of oocyst was confirmed by bright field microscopy. All TRIzol® treated samples were left at room temperature for 10 min and total RNA isolated by chloroform extraction and isopropanol precipitation. RNA was quantified using a NanoDrop™ ND-1000 Spectrophotometer and cDNA was synthesized using SuperScript™ III Reverse Transcriptase (Invitrogen) according to manufacturer’s instructions.

                      Parasite cDNA samples were standardized by relative quantification of an E. tenella β-actin PCR product. β-actin forward primer E0043 (5 ggaattcgttggccgcccaagaatcc 3) and reverse primer E0044 (5 gctctagattagctcggcccagactcatc 3) were used to generate the 1020 bp β-actin cDNA PCR product. Each PCR reaction contained 50 ng of parasite stage specific cDNA, 0.2 μM forward primer, 0.2 μM reverse primer, 1 × AccuPrime™ reaction mix, and AccuPrime™ Pfx DNA polymerase (Invitrogen). The PCR reaction was carried out as follows: initial denaturation 95°C for 3 min; 95°C for 30 s; 61°C for 1 min; 68°C for 1.5 min, for 25 cycles with a final extension at 68°C for 10 min. All products were electrophoresed on a 1% agarose gel and visualized using Gel Red™ (Biotium). The net intensity of each band was determined using the Kodak EDAS 290 Electrophoresis Documentation and Analysis System and serial dilutions performed until relative intensity of PCR products were equal.

                      In addition, three control genes were amplified to determine the purity of parasite lifecycle stages. The GAM56 gene was used as a gametocyte specific gene. GAM56 forward primer E0030 (5 catatggtggagaacacggtgcac 3) and reverse primer E0031 (5 ctcgagttagtaccagctggaggagta 3) were designed to amplify a 906 bp gametocyte cDNA product at an annealing temperature of 61°C. The EtTFP250 gene, a homolog of an E. maxima gene encoding a microneme protein, was used as an asexual stage control. The EtTFP250 forward primer Et250F (5 gcaaggacgttgacgagtgtg 3) and Et250RV1 (5 gttctctccgcaatcgtcagc 3) were designed to amplify an 805 bp cDNA product, at an annealing temperature of 60°C. The chicken lysozyme gene was used to determine relative quantities of contaminating host cDNA. The forward primer RW3F (5 acaaagggaaaacgttcacgattggc 3) and reverse primer RW4R (5 tgcgttgttcacaccctgcatatgcc 3) were designed to amplify a 280 bp host cDNA product at an annealing temperature of 60°C.

                      Semi-quantitative PCR

                      The predicted coding regions of each protease gene were examined for potential primer sites within 1 kb of each other where possible. Primers were designed as detailed in Table 5.
                      Table 5

                      Primers for Eimeria tenella protease genes for the amplified coding sequences

                      Protease gene

                      Primer

                      Primer sequence 5 to 3

                      Aspartic Proteases

                        

                      Eimepsin 1

                      F

                      ATC ACC ACA CCA CCA TGG G

                      R

                      CAA GAT TCG AGC AGT TCT CAG CA

                      Eimepsin 2

                      F

                      AGC AAA CAG CTG CAG ATG TTC C

                      R

                      CGA AAA TAG GTC TAG GGG CCC

                      Eimepsin 3

                      F

                      AGA AGT CCT TTC CTC CGT CAC G

                      R

                      GGC GAA GTG TAT TGA AAG CTC G

                      Cysteine Proteases

                        

                      Cathepsin B

                      F

                      TGA CGT GGG AAG CAG AAG TGT C

                      R

                      ACT GTA TGC ACT CGT GGC GAA A

                      Cathepsin L

                      F

                      CAA CCA ACA AGG TCA CTC TTA C

                      R

                      CCC TGG AGG GCC CCC GTG CTC G

                      Cathepsin C1

                      F

                      AAC GGA AGT GGA GAA GAC AGC A

                      R

                      CGG GGT CAA TGA AGG AAG TTT G

                      Cathepsin C2

                      F

                      GGC TTT GAA GTT TGG CAG CG

                      R

                      TGC ATC TGA GCA GCA GAA GAG

                      Cathepsin C3

                      F

                      CGC TCA GGA GTA CAA CTA CGT GGG TGG

                      R

                      GCT GCT GCA CAA GCA GCG CTG CTC TGC C

                      Calpain

                      F

                      CGA CTG CTC CTT CCT CTC

                      R

                      GCA TCC TTT AGC TGC TGG

                      Ubiquitinyl hydrolase 1

                      F

                      CTG GCT CTT GAA TGT GCT GCA T

                      R

                      CTT CCA TTT CGT GCC ATT CG

                      Ubiquitinyl hydrolase 2

                      F

                      TTG GAC TTC AGC CCG AGG AG

                      R

                      CCG CTC GTC AAA TCC CAA AG

                      Ubiquitinyl hydrolase 3

                      F

                      AGG TGG TGC CCC TCG ACA TA

                      R

                      TTC TGC TGC CGT GCT CTT TG

                      Ubiquitinyl hydrolase 4

                      F

                      GTG AAT GTG GGC AGC ACC AG

                      R

                      GCT TTC CTG CAA GGC GAA GA

                      Ubiquitinyl hydrolase 5

                      F

                      TCT CTT CCA GGG GCA GTA CAG G

                      R

                      GCT GCT CGT AGG CCA TAT TTG AAC

                      Ubiquitinyl hydrolase 6

                      F

                      GGT GGC CAG CAT AGA CGA GAG T

                      R

                      CCG TAG GTT TGC TGC GAT CTC T

                      Ubiquitinyl hydrolase 7

                      F

                      CGA CAG TCC CGT TGT TGC TG

                      R

                      AGC AAG CCG GGG AAA GAG AC

                      Ubiquitinyl hydrolase 8

                      F

                      TCC TGG AGG CCT TGA GCA GT

                      R

                      TGC TGC TCA CTG GGA TGT GG

                      OTU protease

                      F

                      ATG GAC GTA GCA ATC CGT TAC

                      R

                      GTT GCT GCA CAT AGT CCC AAG

                      Pyroglutamyl peptidase

                      F

                      ATG GGA CAA CCT ACA GGC GAG

                      R

                      GAG GAA GTT ACA AAC GAA GCA GC

                      Metallo Proteases

                        

                      Aminopeptidase N 1

                      F

                      CAA GCA GTA CAC TCC AGC AAC TC

                      R

                      GAA GCG TCA GGT GTT CGT ATT CC

                      Aminopeptidase N 2

                      F

                      GAT ACA TCG CAA GGA CTA CAG C

                      R

                      CAT TGT GCG GAA GGA GTC TG

                      ATP-dependant Zn protease 1

                      F

                      CTT CGA CCA GCT GAA GAT CCT G

                      R

                      TGT CTC CGC GCT AAT GCT G

                      ATP-dependant Zn protease 2

                      F

                      CTC AAT GGT GGA TTT CAG CAA G

                      R

                      CAT CAT TCC CTG GCT TGC G

                      ATP-dependant Zn protease 3

                      F

                      GTC AAG AAA GCA GAT TGT CAG G

                      R

                      CTC GAC AGC CAT CTC AAA GTC

                      CAAX prenyl protease

                      F

                      GAA TGT CCC AGG AGA GCT ATG C

                      R

                      GTT CAC AGC GCA CAG AAT TGG

                      Insulysin 1

                      F

                      CAC TTC CTG GAG CAC ATG G

                      R

                      GTG CAG CCT GTC GAA GAT G

                      Insulysin 2

                      F

                      CCG CGG TAG CCT CTCA GC

                      R

                      CTC CGC TGT TGC TCA CAT CTT C

                      Insulysin 3

                      F

                      GAT TGA CGC CGA GCA CCA G

                      R

                      GCT AGG CGA GCT GCT TCA TCC

                      Insulysin 4

                      F

                      GTC GTG CAG AGA GGC TGG

                      R

                      GAG GTA GCT GAG TCG GAG GG

                      Insulysin 5

                      F

                      ATG ATA TTT CTG AAG TCT GC

                      R

                      GAG GAT TCA AAA GAT GGT C

                      Leucine aminopeptidase

                      F

                      CAA GAT CTA GTT GTT TGA GGA GCC C

                      R

                      GCT GTT CCA CTT CAC TCG TCT TC

                      O-sialoglycoprotease

                      F

                      GCA AAT GTG ACG CAG CTG ATT CG

                      R

                      CGA ACT TGA GGG CCA TTT GCT C

                      S2P-like protease

                      F

                      GCC CTC GTA TAA CAG CAA C

                      R

                      GAA CGA CTA ACT TCC TCT TGC

                      Serine Proteases

                        

                      Trypsin 1

                      F

                      GTA GGC AAC GGA ACT CCA GC

                      R

                      CGA GGA CTA CAA CTG TCT CC

                      Trypsin 2

                      F

                      ATG GAA GCG TCT GGT TGG GAC

                      R

                      GCT TTT GCT GCA TGC ACT C

                      Trypsin 3

                      F

                      GAC AAA CAA GTT CAA CGA GCA CTG

                      R

                      GCT TCC CTC TCC GCA GAA TTG

                      Subtilisin 1

                      F

                      TAA TTA CCT CCA TCC CGA ACT G

                      R

                      CCA GAA TCT TCA GCG CCA TCA C

                      Subtilisin 2

                      F

                      GCA GCA GCA AAT GTT GAA GAC CC

                      R

                      ATA AGT GCT GCT GCC AAC CAC C

                      Subtilisin 3

                      F

                      AGA GCT TTT GTC CGT GGT GGA G

                      R

                      AAA GAC CCC GAA AAC CAA TGC T

                      Subtilisin 4

                      F

                      CCT TTG TGG CGT GTT CGT GAG

                      R

                      CCA GCA GAA GCA GTA CCG TGG CC

                      Subtilisin 5

                      F

                      TTG AAG CCG ACA GGA CGT GG

                      R

                      CCG CGT AGT CAA GAG CAG GGA T

                      Subtilisin 6

                      F

                      AGC GGC TGC GAC TTG AAC C

                      R

                      CCG TAG CCG CCG TAG GAG TT

                      Prolyl endopeptidase

                      F

                      ACA GCC AGG CAC ATC AAT GGT

                      R

                      GCC AAA CCC AAG CCC AGA TAG

                      Clp protease

                      F

                      GCT GCA CTT CCA GAA GCG G

                      R

                      CCT CCG CAG AGA AGA CTT TGC

                      Rhomboid protease 1

                      F

                      GGT TGT CCG CAC GTT GGC AG

                       

                      R

                      CGA AGA TAA CAG GCA CGC AAG ATG

                      PCRs were conducted on cDNA samples from E. tenella merozoites, gametocytes, unsporulated and sporulated oocysts. PCR were optimized to produce cDNA sized products. Negative controls of no DNA template and host cDNA were run alongside a positive genomic DNA control. When genomic DNA products were not amplified, a repeat PCR was performed at longer annealing times to produce the often much larger genomic DNA product. A typical PCR was as follows: 1μL of standardized cDNA sample, 0.2 μM forward primer, 0.2 μM reverse primer, 1 × AccuPrime™ reaction mix, and AccuPrime™ Pfx DNA polymerase (Invitrogen). Cycling conditions typically involved an initial denaturation at 95°C for 3 min, followed by 25 cycles of denaturation 95°C for 30 s; annealing at Tm-5 for 1 min; extension at 68°C for 1.5 min. When products were to be sequenced, a final extension at 68°C for 10 min was performed at the end of the PCR reaction. PCRs were performed at least twice and, generally, three times for each gene product by a different researcher each time.

                      All amplified products were gel purified using a QIAquick® Gel Extraction Kit (QIAGEN) according to the manufacturer’s instructions and sequenced (Australian Genome Research Facility, Queensland). When cDNA products were amplified from different parasite stages, these were pooled and used in sequencing reactions. When cDNA products were not obtained, additional primers were designed and used. If a cDNA product was still unable to be amplified with the second primer pair, genomic DNA products were sequenced to confirm primer specificity. Sequences were analysed using DNASTAR Lasergene™ 9 Core suite.

                      GAM56 processing assay

                      A frozen sample of purified E. tenella gametocytes (1 × 106 cells in 100 μL) was resuspended in PBS (145 mM NaCl, 7.5 mM Na2HPO4, 2.5 mM NaH2PO4.2H2O, pH 7.4) to a final volume of 500 μL. Glass beads (250 μL of 710-1180 μm, Sigma) were added to the suspension and vortexed at full speed for three 1 min pulses with a 1 min pause on ice between each pulse. After three vortex cycles, the sample was centrifuged and the lysate transferred to a clean tube. Equal aliquots of the gametocyte extract (18 μL) were immediately added to either 2 μL of 10× protease inhibitor (Table 3) or PBS. A zero time sample was taken from the PBS control and immediately added to Laemmli sample buffer [38] and frozen. The assay tubes were incubated at 37°C for 2, 4, 6, 8, 10, 12, 16 or 24 h, after which Laemmli sample buffer was added and samples stored at −20°C for further assessment.

                      SDS-PAGE and immunoblotting were carried out as described previously [20, 21]. Briefly, gametocyte assay samples, resuspended in Laemmli sample buffer (5 μL), were boiled for 5 min at 100°C prior to SDS-PAGE on a NuPAGE® Novex 4-12% Bis-Tris Gel (Invitrogen). SeeBlue® Plus2 Pre-Stained Standards (Invitrogen) were used as a marker. Proteins separated by SDS-PAGE were transferred electrophoretically (100 V, 1 hour, 4°C) to Immobilon-P membrane (Millipore) in transfer buffer (25 mM Tris–HCl, 192 mM glycine, 10% methanol). Membranes were rinsed in methanol and water then soaked for 10 min in transfer buffer prior to transfer. Gels were pre-soaked for 15 min in transfer buffer. After transfer, membranes were incubated overnight in blocking solution (5% w/v skim milk powder in PBS) at 4°C and then incubated with primary antibody (1:1000 rabbit anti-EmGAM56) for 2 h at room temperature. Each membrane was washed twice for 5 min and twice for 10 min in 0.05% Tween 20 in PBS then incubated with secondary antibody (1:1000 anti-rabbit IgG conjugated to alkaline phosphatase; Sigma) for 2 h at RT. Membranes were washed as above and bands visualized with SIGMA FAST™ BCIP/NBT buffered substrate (Sigma).

                      Declarations

                      Acknowledgements

                      This work was supported by an Australian Research Council Discovery Project grant (DP0664013) and a Department of Innovation, Industry, Science and Research International Science Linkage grant (FR110089). Neither funding body played any role in: the design, collection, analysis, or interpretation of data; the writing of the manuscript; or the decision to submit the manuscript for publication. The authors gratefully acknowledge Professors John Dalton and Michael Wallach (University of Technology, Sydney) for helpful discussions, the staff of the Ernst Facility at the University of Technology, Sydney for their excellent care of the chickens used in this study, and the Parasite Genomics Group at the Wellcome Trust Sanger Institute for providing us pre-publication access to the E. tenella genome database.

                      Authors’ Affiliations

                      (1)
                      Institute for the Biotechnology of Infectious Diseases, University of Technology
                      (2)
                      Queensland Tropical Health Alliance Research Laboratory, Faculty of Medicine, Health and Molecular Sciences, James Cook University
                      (3)
                      INRA UR1282, Equipe Pathogenèse des Coccidioses, Infectiologie Animale et Santé Publique
                      (4)
                      Royal Veterinary College, Hawkshead Lane

                      References

                      1. Li H, Child MA, Bogyo M: Proteases as regulators of pathogenesis: examples from the Apicomplexa. Biochim Biophys Acta 2012, 1824:177–185.PubMedView Article
                      2. Florens L, Washburn MP, Raine JD, Anthony RM, Grainger M, Haynes JD, Moch JK, Muster N, Sacci JB, Tabb DL, Witney AA, Wolters D, Wu Y, Gardner MJ, Holder AA, Sinden RE, Yates JR, Carucci DJ: A proteomic view of the Plasmodium falciparum life cycle. Nature 2002, 419:520–526.PubMedView Article
                      3. Eksi S, Czesny B, Greenbaum DC, Bogyo M, Williamson KC: Targeted disruption of Plasmodium falciparum cysteine protease, falcipain 1, reduces oocyst production, not erythrocytic stage growth. Mol Microbiol 2004, 53:243–250.PubMedView Article
                      4. Eksi S, Czesny B, van Gemeet G-J, Sauerwien RW, Eling W, Williamson KC: Inhibition of Plasmodium falciparum oocyst production by membrane-permeant cysteine protease inhibitor E64d. Antimicrob Agents Chemother 2007, 51:1064–1070.PubMedView Article
                      5. Czesny B, Gosh S, Cook JL, Williamson KC: The proteasome inhibitor epoxomicin has potent Plasmodium falciparum gametocytocidal activity. Antimicrob Agents Chemother 2009, 53:4080–4085.PubMedView Article
                      6. Aminake MN, Schoof S, Sologub L, Leubner M, Kirschner M, Arndt H-D, Pradel G: Thiostrepton and derivative exhibit antimalarial and gametocytocidal activity by dually targeting parasite proteosome and apicoplast. Antimicrob Agents Chemother 2011, 55:1338–1348.PubMedView Article
                      7. Laurent F, Bourdieu C, Kaga M, Chilmonczyk S, Zgrzebski G, Yvore P, Pery P: Cloning and characterization of an Eimeria acervulina sporozoite gene homologous to aspartyl proteinases. Mol Biochem Parasitol 1993, 62:303–312.PubMedView Article
                      8. Jean L, Grosclaude J, Labbe M, Tomley F, Pery P: Differential localisation of an Eimeria tenella aspartyl proteinase during the infection process. Int J Parasitol 2000, 30:1099–1107.PubMedView Article
                      9. Jean L, Pery P, Dunn P, Bumstead J, Billington K, Ryan R, Tomley F: Genomic organisation and developmentally regulated expression of an apicomplexan aspartyl proteinase. Gene 2001, 262:129–136.PubMedView Article
                      10. de Venevelles P, Chich JF, Faigle W, Lombard B, Loew D, Pery P, Labbe M: Study of proteins associated with the Eimeria tenella refractile body by a proteomic approach. Int J Parasitol 2006, 36:1399–1407.PubMedView Article
                      11. Fetterer RH, Miska KB, Barfield RC: Partial purification and characterization of an aminopeptidase from Eimeria tenella . J Parasitol 2005, 91:1280–1286.PubMedView Article
                      12. Li J, Zhang X, Liu Q, Yin J, Yang J: Eimeria tenella: Cloning of a novel Eimeria tenella cDNA encoding a protein related to rhomboid family from F2 hybrid strain. Exp Parasitol 2006, 113:215–220.PubMedView Article
                      13. Fetterer RH, Miska KB, Lillehoj H, Barfield RC: Serine protease activity in developmental stages of Eimeria tenella . J Parasitol 2007, 93:333–340.PubMedView Article
                      14. Lal K, Bromley E, Oakes R, Prieto JH, Sanderson SJ, Kurian D, Hunt L, Yates JR III, Wastling JM, Sinden RE, Tomley FM: Proteomic comparison of four Eimeria tenella life-cycle stages: unsporulated oocyst, sporulated oocyst, sporozoite and second-generation merozoite. Proteomics 2009, 9:4566–4576.PubMedView Article
                      15. Rieux A, Gras S, Lecaille F, Niepceron A, Katrib M, Smith NC, Lalmanach G, Brossier F: Eimeripain, a cysteine cathepsin B-like protease, expressed throughout sporulation of the apicomplexan parasite Eimeria tenella . PLoS One 2012, 7:e31914.PubMedView Article
                      16. Belli SI, Smith NC, Ferguson DJP: The Coccidian oocyst: a tough nut to crack! Trends Parasitol 2006, 22:416–423.PubMedView Article
                      17. Allen MA, Lauro FM, Williams TJ, Burg D, Siddiqui KS, De Francisci D, Chong KW, Pilak O, Chew HH, De Maere MZ, Ting L, Katrib M, Ng C, Sowers KR, Galperin MY, Anderson IJ, Ivanova N, Dalin E, Martinez M, Lapidus A, Hauser L, Land M, Thomas T, Cavicchioli R: The genome sequence of the psychrophilic achaeon, Methanococcoides burtonii: the role of genome evolution in cold adaptation. ISME J 2009, 3:1012–1035.PubMedView Article
                      18. Walker RA, Slapetova I, Slapeta J, Miller CM, Smith NC: The glycosylation pathway of Eimeria tenella is upregulated during gametocyte development and may play a role in oocyst wall formation. Euk Cell 2010, 9:127–135.View Article
                      19. Witcombe DM, Belli SI, Wallach MG, Smith NC: EmTFP250: a novel member of the TRAP protein family implicated in maternal immunity to Eimeria maxima . Int J Parasitol 2003, 33:691–702.PubMedView Article
                      20. Belli SI, Lee M, Thebo P, Wallach MG, Schwartsburd B, Smith NC: Biochemical characterisation of the 56 and 82 kilodalton immunodominant gametocyte antigens from Eimeria maxima . Int J Parasitol 2002, 32:805–816.PubMedView Article
                      21. Belli SI, Ferguson DJP, Katrib M, Slapetova I, Mai K, Slapeta J, Flowers SA, Miska KB, Tomley FM, Shirley MW, Wallach MG, Smith NC: Conservation of proteins involved in oocyst wall formation in Eimeria maxima, Eimeria tenella and Eimeria acervulina. Int J Parasitol 2009, 39:1063–1070.PubMedView Article
                      22. Carlton JM, Hirt RP, Silva JC, Delcher AL, Schatz M, Zhao Q, Wortman JR, Bidwell SL, Alsmark UC, Besteiro S, Sicheritz-Ponten T, Noel CJ, Dacks JB, Foster PG, Simillion C, Van de Peer Y, Miranda-Saavedra D, Barton GJ, Westrop GD, Müller S, Dessi D, Fiori PL, Ren Q, Paulsen I, Zhang H, Bastida-Corcuera FD, Simoes-Barbosa A, Brown MT, Hayes RD, Mukherjee M, Okumura CY, Schneider R, Smith AJ, Vanacova S, Villalvazo M, Haas BJ, Pertea M, Feldblyum TV, Utterback TR, Shu CL, Osoegawa K, de Jong PJ, Hrdy I, Horvathova L, Zubacova Z, Dolezal P, Malik SB, Logsdon JM Jr, Henze K, Gupta A, Wang CC, Dunne RL, Upcroft JA, Upcroft P, White O, Salzberg SL, Tang P, Chiu CH, Lee YS, Embley TM, Coombs GH, Mottram JC, Tachezy J, Fraser-Liggett CM, Johnson PJ: Draft genome sequence of the sexually transmitted pathogen Trichomonas vaginalis . Science 2007, 315:207–212.PubMedView Article
                      23. Mai K, Smith NC, Feng ZP, Katrib M, Slapeta J, Slapetova I, Wallach MG, Luxford C, Davies MJ, Zhang X, Norton RS, Belli SI: Peroxidase catalysed cross-linking of an intrinsically unstructured protein via dityrosine bonds in the oocyst wall of the apicomplexan parasite, Eimeria maxima. Int J Parasitol 2011, 41:1157–1164.PubMedView Article
                      24. Mai K, Sharman PA, Walker RA, Katrib M, DeSouza D, McConville MJ, Wallach MG, Belli SI, Ferguson DJP, Smith NC: Oocyst wall formation and composition in Coccidian parasites. Memorias do Instituto Oswaldo Cruz 2009, 10:281–289.View Article
                      25. Urban S, Wolfe MS: Reconstitution of intramembrane proteolysis in vitro reveals that pure rhomboid is sufficient for catalysis and specificity. Proc Natl Acad Sci USA 2005, 102:1883–1888.PubMedView Article
                      26. Withers-Martinez C, Saldanha JW, Ely B, Hackett F, O’Connor T, Blackman MJ: Expression of recombinant Plasmodium falciparum subtilisin-like protease-1 in insect cells. Characterization, comparison with the parasite protease, and homology modeling. J Biol Chem 2002, 277:29698–29709.PubMedView Article
                      27. Thacker C, Peters K, Srayko M, Rose AM: The bli-4 locus of Caenorhabditis elegans encodes structurally distinct kex2/subtilisin-like endoproteases essential for early development and adult morphology. Genes Dev 1995, 9:956–971.PubMedView Article
                      28. Thacker C, Rose AM: A look at the Caenorhabditis elegans Kex2/Subtilisin-like proprotein convertase family. Bioessays 2000, 22:545–553.PubMedView Article
                      29. Thacker C, Srayko M, Rose AM: Mutational analysis of bli-4/kpc-4 reveals critical residues required for proprotein convertase function in C. elegans . Gene 2000, 252:15–25.PubMedView Article
                      30. Thacker C, Sheps JA, Rose AM: Caenorhabditis elegans dpy-5 is a cuticle procollagen processed by a proprotein convertase. Cell Mol Life Sci 2006, 63:1193–1204.PubMedView Article
                      31. Page AP, Winter AD: Enzymes involved in the biogenesis of the nematode cuticle. Adv Parasitol 2003, 53:85–148.PubMedView Article
                      32. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ: Basic local alignment search tool. Mol Biol 1990, 215:403–410.
                      33. Punta M, Coggill PC, Eberhardt RY, Mistry J, Tate J, Boursnell C, Pang N, Forslund K, Ceric G, Clements J, Heger A, Holm L, Sonnhammer EL, Eddy SR, Bateman A, Finn RD: The Pfam protein families database. Nucleic Acids Res 2012, 40:D290-D301.PubMedView Article
                      34. Rawlings ND, Barrett AJ, Bateman A: MEROPS: the peptidase database. Nucleic Acids Res 2010, 38:D227-D233.PubMedView Article
                      35. Shirley MW, Bushell AC, Bushell JE, McDonald V, Roberts B: A live attenuated vaccine for the control of avian coccidiosis: trials in broiler breeders and replacement layer flocks in the United Kingdom. Vet Rec 1995, 137:453–457.PubMedView Article
                      36. Smith NC, Wallach M, Miller CMD, Morgenstern R, Braun R, Eckert J: Maternal transmission of immunity to Eimeria maxima : ELISA analysis of protective antibodies induced by infection. Infect Immun 1994, 62:1348–1357.PubMed
                      37. Wallach MG, Mencher D, Yarus S, Pillemer G, Halabi A, Pugatsch T: Eimeria maxima: Identification of gametocyte protein antigens. Exp Parasitol 1989, 68:49–56.PubMedView Article
                      38. Laemmli UK: Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 1970, 227:680–685.PubMedView Article

                      Copyright

                      © Katrib et al.; licensee BioMed Central Ltd. 2012

                      This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://​creativecommons.​org/​licenses/​by/​2.​0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

                      Advertisement