The use of Open Reading frame ESTs (ORESTES) for analysis of the honey bee transcriptome

  • Francis MF Nunes1, 2,

    Affiliated with

    • Valeria Valente3,

      Affiliated with

      • Josane F Sousa3,

        Affiliated with

        • Marco AV Cunha2,

          Affiliated with

          • Daniel G Pinheiro1, 2,

            Affiliated with

            • Rafaela M Maia3,

              Affiliated with

              • Daniela D Araujo3,

                Affiliated with

                • Maria CR Costa2,

                  Affiliated with

                  • Waleska K Martins4,

                    Affiliated with

                    • Alex F Carvalho4,

                      Affiliated with

                      • Nadia Monesi5,

                        Affiliated with

                        • Adriana M Nascimento6,

                          Affiliated with

                          • Pablo MV Peixoto7,

                            Affiliated with

                            • Maria FR Silva7,

                              Affiliated with

                              • Ricardo GP Ramos3,

                                Affiliated with

                                • Luis FL Reis4,

                                  Affiliated with

                                  • Emmanuel Dias-Neto8,

                                    Affiliated with

                                    • Sandro J Souza4,

                                      Affiliated with

                                      • Andrew JG Simpson9,

                                        Affiliated with

                                        • Marco A Zago2, 10,

                                          Affiliated with

                                          • Ademilson EE Soares1,

                                            Affiliated with

                                            • Marcia MG Bitondi6,

                                              Affiliated with

                                              • Enilza M Espreafico3,

                                                Affiliated with

                                                • Foued S Espindola7,

                                                  Affiliated with

                                                  • Maria L Paco-Larson3,

                                                    Affiliated with

                                                    • Zila LP Simoes6,

                                                      Affiliated with

                                                      • Klaus Hartfelder3, 6Email author and

                                                        Affiliated with

                                                        • Wilson A SilvaJr1, 2

                                                          Affiliated with

                                                          BMC Genomics20045:84

                                                          DOI: 10.1186/1471-2164-5-84

                                                          Received: 07 June 2004

                                                          Accepted: 03 November 2004

                                                          Published: 03 November 2004

                                                          Abstract

                                                          Background

                                                          The ongoing efforts to sequence the honey bee genome require additional initiatives to define its transcriptome. Towards this end, we employed the Open Reading frame ESTs (ORESTES) strategy to generate profiles for the life cycle ofApis melliferaworkers.

                                                          Results

                                                          Of the 5,021 ORESTES, 35.2% matched with previously depositedApisESTs. The analysis of the remaining sequences defined a set of putative orthologs whose majority had their best-match hits withAnophelesandDrosophilagenes. CAP3 assembly of theApisORESTES with the already existing 15,500ApisESTs generated 3,408 contigs. BLASTX comparison of these contigs with protein sets of organisms representing distinct phylogenetic clades revealed a total of 1,629 contigs thatApis melliferashares with different taxa. Most (41%) represent genes that are in common to all taxa, another 21% are shared between metazoans (Bilateria), and 16% are shared only within the Insecta clade. A set of 23 putative genes presented a best match with human genes, many of which encode factors related to cell signaling/signal transduction. 1,779 contigs (52%) did not match any known sequence. Applying a correction factor deduced from a parallel analysis performed withDrosophila melanogasterORESTES, we estimate that approximately half of these no-match ESTs contigs (22%) should representApis-specific genes.

                                                          Conclusions

                                                          The versatile and cost-efficient ORESTES approach produced minilibraries for honey bee life cycle stages. Such information on central gene regions contributes to genome annotation and also lends itself to cross-transcriptome comparisons to reveal evolutionary trends in insect genomes.

                                                          Background

                                                          The honey bee,Apis mellifera, occupies a prominent place in biological research due to its social behavior, learning capabilities, haplodiploid mechanism of sex determination, and plasticity in phenotype (caste) and longevity. Thus, it is a model organism for classical and sociogenetic studies. In addition, bees drive a large-scale apicultural industry, and also generate important income in small-scale subsistence beekeeping. And finally, bees are of great economic and ecological relevance for their role as generalist pollinators.

                                                          The decision to include the honey bee amongst the current organisms for complete genome sequencing,http://​www.​hgsc.​bcm.​tmc.​edu/​projects/​honeybee/​was, therefore, well founded, yet information on its transcriptome is still meager. When starting this study, little over 250 genes were annotated as partial or full length coding sequences, and only about 15,500 expressed sequence tags (mainly 5'-ESTs generated from a normalized bee brain cDNA library [1]) were available in public databases. Thus, even after sequencing of the honey bee genome will be completed a considerable transcriptome sequencing effort will still be required for unequivocal genome annotation, gene identification, and subsequent functional studies.

                                                          We used the ORESTES (Open Reading frame Expressed Sequence Tags) strategy to generate ESTs from different life cycle stages of the honey bee, such as appropriate for a genome annotation initiative. This strategy preferentially generates ESTs of the central, and thus most informative portion of the transcript [2], and frequently also identifies less abundant mRNAs [3]. The efficacy of the Open Reading frame ESTs strategy, in the context of an organism for which there is limited genomic information, has recently been demonstrated forSchistosoma mansoni[4].

                                                          This cost-efficient approach increased the already existentApisEST database by 30% new reads. Of the 5,021 ORESTES, only 35.2% matched with previously depositedApisESTs. When assembled with the existentApisESTs in the NCBI database, the ORESTES sequences extended 66% of the mixed contigs. Together these data indicate that the ORESTES methodology could effectively complement the current efforts towards the definition of theApistranscriptome.

                                                          Results and discussion

                                                          Honey bee Open Reading frame ESTs

                                                          We generated a total of 87 mini-libraries from the four major life cycle stages of honey bee workers (embryo, larva, pupa, adult) by the use of arbitrary primers and a low-stringency RT-PCR protocol [2]. From these libraries we obtained 5,021 sequences of appropriate standard quality (sequence > 100 bases; Phred 15) and with an average size of 373.9 bp. These sequences were deposited in the GenBank EST database (accession numbers CK628548 to CK633568). In the annotation pipeline, these were first submitted to BLASTN searches againstApis melliferasequences deposited in the NCBI EST database (dbEST). At this step, 35.2% (1,769) of the validated sequences matchedApisESTs (Table1). In a subsequent step, a BLASTX comparison of the remaining sequences against the nr-NCBI database permitted the annotation of an additional 22.4% (1,123) of the honey bee ORESTES, while the remaining 42.4% (2,129) did not match any known sequence. This rather large set of ESTs that did not result in significant alignment with any sequence deposited in non-redundant databases contains candidates for novel honey bee genes.
                                                          Table 1

                                                          Apis melliferaOpen Reading frame ESTs.

                                                          Sequencing results

                                                          Number of reads

                                                          Total analyzed reads

                                                          5021

                                                          - Embryos

                                                          1358

                                                          - Larval stages

                                                          720

                                                          - Pupae

                                                          1219

                                                          - Adults

                                                          1479

                                                          - Stage mix

                                                          245

                                                          Local alignment matches

                                                           

                                                          -ApisESTs from dbEST

                                                          1769a

                                                          -Apis melliferasequences in GenBank

                                                          16*b

                                                          - Genes of other organisms (orthologs)

                                                          1123b

                                                          - No matches in GenBank

                                                          2129

                                                          Clusterization results

                                                           

                                                          - Number of contigs

                                                          488

                                                          - Number of singlets

                                                          893

                                                          - Total number of clusters

                                                          1381

                                                          aBLASTN against dbEST using an E-score of 10-30as cutoff value;bBLASTX against the nr database used <10-15as the cutoff. *This set is also represented by ESTs in the dbEST database. It is included here as additional information only and is not to be summed up with the other matches.

                                                          The 5,021ApisORESTES were assembled by CAP3 into 488 contigs of a mean size of 519 bp, leaving 893 singlets. In a second round of BLASTX comparisons against the nr-NCBI database, 28.5% of the contigs and 9.2% of the singlets were classified as putative orthologs. When the respective best matches were classified according to species or higher order taxa (Figure1), 89.6% were from the arthropod clade (including fully or partially sequencedApis melliferagenes). The largest fraction of these putative orthologs showed best matches with predictedAnophelesgenes (43.9%), followed by ORESTES that were classified as putative orthologs ofDrosophila(29.5%).
                                                          http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-5-84/MediaObjects/12864_2004_Article_186_Fig1_HTML.jpg
                                                          Figure 1

                                                          Distribution of Best-BLASTX-matches for assembledApis melliferaOpen Reading frame ESTs. After assembly into contigs and singlets the sequences were submitted to a search against a non-redundant protein database (NCBI). Independent of its E-score, the best match in each BLASTX result was listed according to organism category.

                                                          Gene Ontology classification

                                                          We assigned level 3 Gene Ontology (GO) classifications to 326 of the total of 488 assembled contigs; 162 contigs did not match any sequence in the nr-protein database. In the manual annotation preceding the GO analysis we preferentially assigned the contigs with respect to theirDrosophilaorthologs. The cellular component, biological process, and molecular function classifications of the honey bee sequences are shown in Table2. In the biological process categories there is a clear prevalence for ESTs representing cell communication, cell growth and maintenance, metabolism and morphogenesis. For molecular function, the dominant assignments were to enzymatic activity and to nucleic acid binding and related functions (translation factor, transcription factor). When compared to the corresponding GO results obtained for the bee brain ESTs [1], we noted a similar distribution in category dominance structure, except for the molecular functions 'transporter and ligand binding/carrier' which have a higher representation in the bee brain ESTs than in our ORESTES contigs. This discrepancy most probably reflects functional differences in the tissues used in these two studies.
                                                          Table 2

                                                          Gene Ontology classification ofApis melliferaORESTES contigs according to theDrosophilagenes that they represent.

                                                          Gene Ontology

                                                          Number of genes

                                                          Cellular Component

                                                           

                                                          extracellular matrix

                                                          4

                                                          extracellular space

                                                          5

                                                          intracellular

                                                          99

                                                          membrane

                                                          29

                                                          others

                                                          8

                                                          Biological Process

                                                           

                                                          reproduction

                                                          18

                                                          cell motility

                                                          7

                                                          response to stress

                                                          6

                                                          cell communication

                                                          25

                                                          pattern specification

                                                          10

                                                          cell growth and/or maintenance

                                                          55

                                                          metabolism

                                                          79

                                                          response to external stimulus

                                                          10

                                                          morphogenesis

                                                          24

                                                          embryonic development

                                                          9

                                                          cell differentiation

                                                          9

                                                          others

                                                          41

                                                          Molecular Function

                                                           

                                                          nucleotide binding

                                                          14

                                                          nucleic acid binding

                                                          40

                                                          RNA polymerase II transcription factor activity

                                                          7

                                                          antimicrobial peptide activity

                                                          3

                                                          helicase activity

                                                          4

                                                          receptor signaling protein activity

                                                          5

                                                          structural constituent of cytoskeleton

                                                          5

                                                          microfilament motor activity

                                                          5

                                                          transcription factor activity

                                                          6

                                                          kinase activity

                                                          14

                                                          oxidoreductase activity

                                                          22

                                                          transferase activity

                                                          23

                                                          hydrolase activity

                                                          38

                                                          protein binding

                                                          29

                                                          metal ion binding

                                                          9

                                                          ion transporter activity

                                                          8

                                                          others

                                                          70

                                                          GO levels were set at 3. In either of the GO categories, individual contigs may be listed in more than one category. This GO classification only includes Apis mellifera orthologs to Drosophila genes that are represented by a Flybase code.

                                                          Clustering of honey bee ESTs

                                                          We clustered the contigs generated in this study (AmORESTES contigs) with theApis melliferaESTs already present in the NCBI dbEST database (further referred to as AmNCBI contigs). Clustering performed by CAP3 resulted in a total of 3,408 contigs and led to a general increase in read depth (Figure2A). This increase in read depth is reflected in the CAP3 assembled mixed sequences of the two databases. Mean length is 696 bp for the AmNCBI contigs and 496 bp for the AmORESTES contigs (Figure2B). For the mixed contigs we noted a mean increase of about 150 bp in contig length, thus documenting that the ORESTES sequences add considerable information to the characterization of the honey bee transcriptome and for subsequent studies of specific genes.
                                                          http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-5-84/MediaObjects/12864_2004_Article_186_Fig2_HTML.jpg
                                                          Figure 2

                                                          CAP3 assembly ofApis melliferaOpen Reading frame ESTs (AmORESTES) withApis melliferaESTs previously deposited in dbEST (AmNCBI). A) Read depth distribution of pure AmNCBI or AmORESTES and of mixed contigs; B) EST size distribution of these contigs, C) Details of individual mixed contigs showing the extension and gap-closing characteristics. In all graphs, AmORESTES sequences are in blue, AmNCBI contigs are in red, and mixed contigs are in green.

                                                          Within the total contig population, 9.5% of the assembled sequences (323) are represented by mixed contigs of both AmORESTES and AmNCBI sequences, and within this group 66.3% (214) of the original AmNCBI contigs were considerably extended, or were joined across gaps by the AmORESTES contigs, as illustrated in Figure2C. The fact that the number of mixed contigs is relatively low compared to total contig number may be attributed to two aspects. First, most of the AmNCBI contigs were obtained from a single tissue (brain) library, whereas the AmORESTES sequences represent whole body transcripts of all life cycle stages of the honey bee. Second, the AmNCBI sequences are mainly 5'-ESTs, whereas the AmORESTES sequences are expected to cover more central cDNA regions.

                                                          Genome comparison

                                                          Even though the total number of ESTs available forApis melliferais still low when compared to established genomic model organisms, we performed an across genome analysis with the set of 3,408 honey bee contigs. This involved sequential BLASTX searches, using the honey bee sequences as query entries against protein databases ofDrosophila melanogaster, Anopheles gambiae, Caenorhabditis elegans, human, protozoan and fungal origin. With this selection of organisms we intended to extract information on the percentage of genes thatApisshares (i) with all organisms, (ii) with animals, (iii) with different sets of metazoans, (iv) and exclusively with insects. The cutoff E-value in these comparisons was set at 10-6, as used in comparisons of similar nature [4], and the representation of the respective putative orthologs was listed across taxonomic levels.

                                                          We found that 1,629Apiscontigs presented significant match with sequences belonging to at least one of the taxa genomes. From these, 460 contigs (28.2%) correspond to genes with a representation in all the above taxa (Figure3). In addition, further 211 contigs (12.9%) could also be classified as common to all organisms since they were represented in all but in one of the members of this set of taxa (at this level,AnophelesandDrosophilawere considered as a single group representing Diptera). This increases the set of EST contigs that the honey bee may share with all organisms to 41.2%, or, when considering the entire set of 3,408 contigs, to 19.7%. The second largest set of ESTs (312 + 37 contigs) is the one that is represented as genes common to the bilaterian clade (or metazoans in general), and only the third largest set (198 + 68 ESTs) contains genes that are represented solely in hymenopterans and dipterans, and thus in the insect clade.
                                                          http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-5-84/MediaObjects/12864_2004_Article_186_Fig3_HTML.jpg
                                                          Figure 3

                                                          Similarity and representation pattern of assembledApis melliferaESTs (ORESTES + NCBI dbESTs) with predicted proteins of other organisms. In this comparison we included eukaryotes with completely sequenced genomes (Drosophila melanogaster,Anopheles gambiae,Caenorhabditis elegansand human), plus higher taxon groups, such as protozoans (primarily represented byPlasmodium falciparumandP. yoelii) and fungi (primarily represented bySaccharomyces cerevisiae,Schizosaccharomyces pombeandNeurospora crassa). These BLASTX comparisons were performed with an E-value cut-off level set at 10-6. Subsequently, the representation pattern of each of theApisESTs in each of the eukaryotic genomes was listed. Out of the total 3,408ApisEST contigs, 1,629 could be classified as putative orthologs, and these were grouped according to the representation of these genes at the different taxonomic levels.

                                                          Since deep-level phylogeny relationships within the bilateria are still a matter of debate, we separated our dataset according to the two prevalent hypotheses. The traditional view clusters arthropods within the coelomate clade. In our set of genomes, this tree architecture would be represented by genes shared between insects and the human genome. The alternative, more recently proposed hypothesis joins arthropods with nematodes to form an ecdysozoan clade [5]. The result of our comparison, which places emphasis on shared genes and not on the frequency of gene losses, is more consistent with the traditional view, since the coelomate clade is represented in this analysis with almost five times more shared genes than the ecdysozoan clade.

                                                          To infer on functional aspects within this pattern of genes that different clades appear to have in common we performed a Gene Ontology classification on biological process. In the set ofApisESTs that stands for genes putatively shared with all organisms, the majority was classified as having a role in metabolism, and thus can be considered to represent basic functions. In contrast, the majority ofApisESTs that are shared within the insect clade was represented in the biological process categories of cell growth and/or maintenance and cell communication. The corresponding insect-specific genes are therefore supposedly involved in more specialized functions. A similar conclusion can be reached from the micro- and macroarray analyses of transcripts detected in adult honey bee workers performing different tasks during their adult life cycle [6,7].

                                                          A total of 70 putative ortholog ESTs did not comply with any of the plausible phylogenies, yet nevertheless, this set may contain ESTs of interesting information content, especially when considering that the main set of genes within this group consists ofApis melliferacontigs that overlap with a mammalian genome. A manual analysis of these 23 contigs by BLASTX against the nr-NCBI database revealed that they are (at least by three orders of magnitude in E-values) more similar to mammals (especially to humans) than to other vertebrates and even other insects. This suggests that these genes may have diverged less inApisand mammals and, therefore, may be subject to related selection pressure. Alternatively, at least some of them may have been modified in Diptera, and thus would show up as insect genes only once further non-dipteran insect genomes or transcriptomes have been sequenced and annotated. As shown in Table3, this set of bee/human contigs contains a considerable number of predicted proteins related to cell signaling/signal transduction and transcription factors. Such a bias to information processing in our dataset of genes shared between honey bees and a mammalian genome may reveal system properties related to complex functions.
                                                          Table 3

                                                          Annotation and Gene Ontology characteristics of 11 honey bee EST contigs sharing significant similarity with mammalian but not with other vertebrate or invertebrate sequences. In all cases, the best match was with human proteins. For these 11 out of 23 contigs we could retrieve functional information.

                                                          ApisEST contig

                                                          E-score value a

                                                          GO, Biological process b

                                                          Human LOCUS ID GenBank annotation

                                                          Additional information

                                                           

                                                          Human

                                                          Insect

                                                             

                                                          437

                                                          2e-67

                                                          NA

                                                          without result

                                                          NM_019116: ubiquitin binding protein

                                                          ubiquitin-specific protease domain

                                                          663

                                                          3e-10

                                                          NA

                                                          without result

                                                          NM_182830: MAM domain

                                                          contactin 5; neural adhesion molecule

                                                          1081

                                                          5e-07

                                                          9.7

                                                          without result

                                                          NM_013041: RAB3A interacting protein (rabin3)-like1

                                                          guanin nucleotide exchange factor domain

                                                          1425

                                                          8e-27

                                                          NA

                                                          without result

                                                          NM_182565: hypothetical protein MGC29814

                                                          TBP-associated factor 4; TATA box binding protein

                                                          1674

                                                          4e-82

                                                          NA

                                                          without result

                                                          NM_172374: interleukin 4 induced 1

                                                          none

                                                          1953

                                                          7e-11

                                                          NA

                                                          without result

                                                          NM_024707: gem (nuclear organelle) associated protein

                                                          spliceosomal snRNP biogenesis

                                                          2807

                                                          8e-07

                                                          5e-04

                                                          regulation of physiological process

                                                          NM_138457: forkhead box P4

                                                          transcription factor activity

                                                          2896

                                                          4e-05

                                                          0.002

                                                          reproduction, metabolism

                                                          NM_004654: ubiquitin-specific protease 9

                                                          ubiquitin thiolesterase activity

                                                          3167

                                                          2e-27

                                                          7e-05

                                                          cell communication

                                                          NM_033046: rhotekin

                                                          signal transduction

                                                          3347

                                                          5e-26

                                                          7.5

                                                          without result

                                                          NM_014006: PI-3-kinase-related kinase SMG-1

                                                          involved in nonsense-mediated mRNA decay

                                                          3374

                                                          1e-10

                                                          0.18

                                                          cell communication,

                                                          NM_014035: sorting nexing 24

                                                          intracellular signaling cascade

                                                          aE-value of the contig alignment with human or known insect sequences, NA: did not show any alignment;bGene Ontology results on Biological Process, FatiGO level 3,cadditional information obtained from Entrez Gene - NCBI and GOA link (GOAnnotations@EBI - European Bioinformatics Institute).

                                                          Finally, we found that 1,779 (52,2%) of the assembled EST contigs did not match with any sequence of the analyzed organisms. Such a large proportion ofApis-specific contigs is likely to be an overestimate. As noted in a previous study [1], this might be partly due to technical problems, such as, sequencing of cDNA inserts consisting mainly of 3'-untranslated regions, the presence of unspliced intron sequences, cDNAs with a negative reading frame, or chimaeric cDNAs. However, the major portion of theApis-specific contigs may have become classified as species-specific due to their relatively short ORFs. We performed an ESTScan analysishttp://​www.​ch.​embnet.​org/​software/​ESTScan.​htmlon theApis-specific contigs which detected ORFs in 56% of the assembled ESTs. These ORFs are, however, relatively short, with a mean ORF length around 280 bp. Short ORF length represents a notorious problem to alignment algorithms resulting in low match scores, and consequently, a more frequent classification of short ORF ESTs as species-specific transcripts. For the honey bee, this has been shown for the brain cDNA library where 84% of the ESTs with ORFs shorter than 450 bp were classified as species-specific, against 24% in the EST set that had ORFs larger than 450 bp [1].

                                                          In order to gain a general perspective on the representation of species-specific ESTs we also directed our attention to estimates obtained in whole-genome cross-species analyses. For instance, a figure of 18.6% of species-specific genes was ascertained forDrosophila melanogasterin a genome comparison which includedAnopheles gambiaeas the other insect representative [8]. Based on this information, and taking advantage of a set ofDrosophila melanogasterORESTES, generated in a parallel project, we calculated the frequency ofDrosophila-specific ORESTES sequences to obtain a more realistic estimate onApis-specific genes in relatively small sets of ESTs. In this analysis, a set of 5,000 CAP3 assembledDrosophilaORESTES (409 contigs) was submitted to sequential BLASTX searches against protein databases ofDrosophila melanogaster,Anopheles gambiae,Caenorhabditis elegans, human, protozoan and fungal, as described for theApiscontigs. For comparison, this same analysis was also performed withApisESTs, using separately 5,000 AmORESTES (486 contigs) and 5,000 AmNCB (632 contigs).

                                                          TheDrosophilaandApisEST contigs consistently showed relatively low proportions of insect-specific genes (6–13%). Still lower (ca. 1% each) was the proportion of ESTs that had significantly higher similarity scores with eukaryotes other than Insecta. In all EST sets we found a large fraction of sequences that were classified as eitherDrosophila-specific (40%) orApis-specific (51% for AmNCBI dbESTs and 47% for AmORESTES). This high proportion of species-specific genes, therefore appears to be generated independent of the method used in EST sequencing, as it is represented in similar proportions in both the ORESTES set and the conventional 5'-EST set (Figure4).
                                                          http://static-content.springer.com/image/art%3A10.1186%2F1471-2164-5-84/MediaObjects/12864_2004_Article_186_Fig4_HTML.jpg
                                                          Figure 4

                                                          Percentage of honey bee andDrosophilaESTs representing putative species-specific genes (blue bars) in relation to ESTs that represent genes solely shared within the insect clade (pink bars), or that have higher similarity with eukaryotes other than the insect clade (yellow bars). In separate comparisons, theApis melliferacontigs (ORESTES + NCBI dbESTs, n = 5,000), AmORESTES (n = 5,000), AmNCBI dbESTs (n = 5,000), andDrosophila melanogasterORESTES contigs (n = 5,000) were analyzed against protein databases of an insect (Anopheles gambiae) and several non-insect species (C. elegans, protozoans, fungi andH. sapiens) with completely sequenced genomes. The cut-off E-value in these comparisons was set at 10-6.

                                                          The figure of 40%Drosophila-specific genes obtained for ourDrosophilaORESTES set can be directly set in contrast with the estimate of 18,6% species-specific genes reported in theDrosophilagenome based study [8], and this would predict an overestimate factor of 2.15 for species-specific genes in the EST sets. When this factor is applied to the honey bee ORESTES, the 47% estimate for species-specific AmORESTES can thus be corrected to a more realistic figure of 22%. This estimate is in agreement with the results of Whitfield et al. [1] who observed that 24% of the honey bee genes represented by ESTs with ORFs larger than 450 bp did not have matches to any known protein sequences. ThisApis-specific gene estimate is also in range when considering that the two dipteran species are thought to have separated from a common ancestor approximately 250 million years ago, whereas the postulated sister-group relationship of Hymenoptera and Mecopteroidea [9] suggests a pre-permian divergence, with a predicted separate lineage evolution of over 280 million years for honey bees and dipterans [10].

                                                          Conclusions

                                                          The generation of a relative small set of Open Reading frame ESTs (ORESTES) that match and complement the already existentApisEST database shows that this approach is sufficiently robust and favorably complements other strategies, such as ESTs prepared from normalized cDNA libraries. Its inherent properties of detecting transcripts of low abundance and aligning with central regions of transcripts [2,3] also make it a suitable tool in searches for novel honey bee genes and their annotation in parallel with ongoing genome sequencing projects. Furthermore, the genome comparisons performed in this and other studies [1,11] highlight that the elevated number of putativeApis-specific genes will still require extensive transcriptome sequencing for high quality genome annotation, and will play an important role in the question of insect genome organization and model systems in comparative studies [12].

                                                          Methods

                                                          Biological samples and RNA extraction

                                                          Samples of the four major stages of the honey bee life cycle were collected fromApis melliferacolonies (Africanized hybrids) kept in the experimental apiary of the Dept. Genetics, Univ. São Paulo, Campus Ribeirão Preto, Brazil. Each embryo sample contained approximately 300 eggs retrieved from a frame on which the queen had been caged for up to 72 hours. This assured that we covered the entire embryonic period. The larval sample was a representation of all five instars and included also spinning-stage larvae. Prepupae and pupae, including white-eyed, pink-eyed, brown-eyed and pigmenting pupae, were pooled into the pupal samples. For the adult sample we collected newly emerged bees, a random sample of hive bees (picked from a brood frame), and returning foragers. All these samples were snap frozen in liquid nitrogen. Total RNA was isolated using TRIzol reagent (Invitrogen). The lipid-rich larval and pupal samples required two additional extraction steps with phenol/chloroform and chloroform to obtain RNA of adequate purity.

                                                          In the case ofDrosophila melanogaster, dechorionated embryos, larvae plus prepupae and pupae, as well as adult flies were collected from an isogenicy,w 1118stock ofDrosophila melanogaster. These were immediately frozen in liquid nitrogen and stored at -80°C until use. Total RNA was extracted with TRIzol, as described forApis mellifera.

                                                          Generation of Open Reading frame ESTs (ORESTES)

                                                          From high quality DNA-free total RNA samples we isolated poly(A)+RNA using an Oligotex II (Qiagen) kit. To assess poly(A)+RNA quality of the samples we performed Northern blot hybridizations with an actin (Apis mellifera) or tubulin (Drosophila melanogaster) probe. The probes were labeled by a random priming reaction in the presence of [α-32P]dCTP. The actin fragment was amplified using the primers described in Table4. TheDrosophilatubulin probe was already available from previous studies. High quality total RNA preparations were subjected to a DNase I treatment, and the absence of DNA contaminants was assessed by Southern blot hybridization of PCR products amplified withApisorDrosophila16S mitochondrial DNA primers, respectively. High quality poly(A)+RNAs were aliquoted and stored at -80°C.
                                                          Table 4

                                                          Specific primers used to assess quality and absence of DNA contaminants of the RNA samples, and randomly selected primers used to generate cDNA profiles.

                                                          Primer code

                                                          Sequence

                                                          actin F (Apis)

                                                          5' AGCTATGAACTTCCAGATGGT 3'

                                                          actin R (Apis)

                                                          5' CCACATCTGTTGGAAGGT 3'

                                                          16S mitochondrial F (Apis)

                                                          5' TTATTCACCTGTTTATCAAAACAT 3'

                                                          16S mitochondrial R (Apis)

                                                          5' 'TATAGATAGAAACCAAYCTG 3'

                                                          16S mitochondrial F (Drosophila)

                                                          5' CCGGTCTGAACTCAGATCACGT 3'

                                                          16S mitochondrial R (Drosophila)

                                                          5' CGCCTGTTTAACAAAAACAT 3'

                                                          p3_2

                                                          5' TTGGGGATCGTATGTAGTATG 3'

                                                          pA82_1

                                                          5' CACTTCAGGATCCCTTGTAAGC 3'

                                                          pA82_2

                                                          5' CCAACATTGAATTCTCTTTGAC 3'

                                                          pA82_4

                                                          5' CAATAACAATGAATTCCAGAATCTCG 3'

                                                          pPT7C4_B

                                                          5' GCTTACAAGGGATCCTGAAGTGTTTCC 3'

                                                          pPT7C4_XS

                                                          5' GCAGGTAAACTCTACTCGAGTTACG 3'

                                                          M-RON-AS

                                                          5' CCAGGATGTTTGGGTGATGTA 3'

                                                          CREB-S

                                                          5' TCATGCAACATCATCTGCTCC 3'

                                                          H-SPARC-S

                                                          5' CTAACCCAAGACATGACATTC 3'

                                                          M-CD151-S

                                                          5' AAAGCTCGGAGGCAGCGAACT 3'

                                                          H-CD151-AS

                                                          5' CATGTGGCTGCAAGGCAAAGC 3'

                                                          M-SPARC-AS

                                                          5' GCCCAATTGCAGTTGAGTGAT 3'

                                                          M-ETS1-AS

                                                          5' GTCTTGATGATGGTGAGAGTC 3'

                                                          FUT-3-S

                                                          5' TCATGTCCAACCCTAAGTCAC 3'

                                                          FUT-3-AS

                                                          5' TCCAGCAGGCCTTGCAGAAAT 3'

                                                          M-CMET-S

                                                          5' TATCTCAAACGATCGAGAGAC 3'

                                                          M-CMET-AS

                                                          5' GCACATCTATTACCAGCTTTG 3'

                                                          H-CMET-S

                                                          5' TTTCAAATGGCCACGGGAC 3'

                                                          H-CMET-AS

                                                          5' GCACATTTATGACCATTCTCG 3'

                                                          H-Rhoc-AS

                                                          5' AGAAACAACTCCAGGGGCCTG 3'

                                                          M-Rhoc-AS

                                                          5' CTACCCAAAGCAGAAACCCCA 3'

                                                          H-Sparc-AS

                                                          5' CCAAAACCATCCTTGACAACA 3'

                                                          H-RON-AS

                                                          5' TGATGAGGTCCTTCACGGTG 3'

                                                          B237-2

                                                          5' CGGAATTCACCAGATTTGAACAGAAGAG 3'

                                                          B237-3

                                                          5' AACTGCAGTTAACCAGATTTGAACAGAAA 3'

                                                          GST_(PGEX)_NHE_I-S

                                                          5' CCGCTAGCATGTCCCCTATACTAGGTTA 3'

                                                          HOXA_I-F

                                                          5' CGCTCCCGCTGTTTACTCT 3'

                                                          P21-RasaI-F

                                                          5' GACCGCTCCTCCAACTAACC 3'

                                                          P21-RasaI-R

                                                          5' CCGGCCCACCTCTTCTACTA 3'

                                                          SRY8299.2

                                                          5' TCTCTTTATGGCAAGACTTACG 3'

                                                          SRY1532.1

                                                          5' TCCTTAGCAACCATTAATCTGG 3'

                                                          92R7.2

                                                          5' GCCTATCTACTTCAGTGATTTCT 3'

                                                          TAFIEX.1R

                                                          5' ATCCAAGGTTCTCCCAATA 3'

                                                          ORESTES profiles were generated according to Dias-Neto et al. [2]. Briefly, aliquots of 15 ng of purified mRNA were subjected to reverse transcription reactions utilizing SuperScript II Reverse Transcriptase (Invitrogen) and a set of randomly selected primers (Table4). First-strand cDNA synthesis occurred at 37°C for 60 min in a total volume of 20 μl. The products of this reaction were diluted 1:5 in water and stored at -20°C. The cDNAs contained in 1 μl of each diluted RT-product were then amplified by PCR using the same or a single alternative random primer in a PCR mix (Ready-to-Go PCR bead, Amersham Biosciences). The amplification protocol consisted of an initial step at 75°C for 5 min, followed by a 45 cycles touchdown series (95°C for 30 s, a gradually decreasing annealing temperature from 66 to 44°C lasting 10 s per step and a decrease of 2°C per step, 72°C for 1 min), and a final extension reaction at 72°C for 7 min.

                                                          Aliquots of the PCR products (3–5 μl) were run on 1% agarose gels and stained with ethidium bromide. From profiles that presented near-even smears we excised two sets of amplification products, one covering a size range from 300 to 700 bp and a second one from 700 to 1500 bp. For cloning, these were extracted from the agarose gels (QIAquick Gel Extraction kit, Qiagen) and ligated into pUC18 (SureClone Ligation kit, Amersham Biosciences) for transformation of competentE. coliDH5α-cells by heat shock. Bacteria were grown in 2 × YT medium before aliquots were plated on 2 × YT agar containing ampicillin.

                                                          Blue-white selected positive colonies were picked, grown overnight in 2 × YT medium in 96-well plates, and used as templates for PCR using vector primers (M13 forward and reverse). An aliquot of each amplification product was analyzed on a 1% agarose gel before another 1 μl aliquot was submitted to DNA sequencing using standard protocols of the DYEnamic™ ET Terminator kit (Amersham Biosciences). The reaction products were analyzed in a MegaBACE™ 1000 automated sequencer. Only profiles with more than 80% positive PCR reactions were sequenced.

                                                          Sequence analysis

                                                          After passing through theBase Caller Cimaron 1.53 Slim Phredfy(insert size > 100, "N" nucleotides less than 20%, and "N" repetitions of less than 6 nucleotides) and ScoreCard procedure (MegaBACE™) to check sequences quality, reads that were larger than 100 nt were submitted to an automated protocol for data analysis (Gene Annotation Pipeline) of theApis melliferaorDrosophila melanogasterORESTES. The protocol consisted of the following steps: conversion of electropherograms (Phred, to formats .fasta, .phd and .qual), primer and vector detection and trimming (Cross_match) and masking of repeats (RepeatMasker). Validated fasta format sequences were then submitted to a general BLASTN search against GenBank entries for mitochondrial and rRNA, as well as bacterial and fungal RNA to detect and eliminate contaminant sequences.

                                                          For theApis melliferaORESTES, subsequent BLASTN searches were performed against the approximately 15,500Apis melliferaEST sequences deposited in GenBank dbEST. In this case, significant E values were set at 10-30. Searches against the non-redundant protein database entries used the BLASTX option with E-values set at 10-10as significance cut-off level.

                                                          CAP3 was used to clusterize the ORESTES sequences of both species. ForApis mellifera, the annotation of the 488 contigs was manually checked, giving preference toDrosophilasequences in the Unigene assignment. Subsequently, the contigs were batch submitted to a Gene Ontology procedure utilizing the FatiGO tools [13]http://​fatigo.​bioinfo.​cnio.​es/​. Clusterization of theApisORESTES contigs and singletons with theApis melliferaESTs deposited in GenBank dbEST was also performed using a CAP3 routine (standard parameters).

                                                          Declarations

                                                          Acknowledgements

                                                          The production ofApisORESTES was supported by grants from FAPESP (99/00719-6 and 98/142476) and that ofDrosophilaORESTES received supported from a grant from Ludwig/FAPESP (99/03677-2). MCRC and NM were research fellows of FAPESP; KH received a CAPES/DAAD visiting professor fellowship, VV, DDA and JFS were supported by fellowships from FAPESP; FMFN, RMM, and MFRS received fellowships from CAPES and PMVP from CNPq. EDN is supported by ABADHS and CNPq grants. We thank Amélia G. Araujo, Fernanda Barbuzano, Cristiane A. Ferreira, Roberto Focosi Jr., Adriana A. Marques, Camila C.B.O. Menezes, Gislaine S.P. Pereira, Marlus C.O. Rocha, Anemari R.D. Santos, Cirlei A.V. Saraiva, Israel T. Silva and Benedita O. de Souza for their dedicated technical assistance.

                                                          Authors’ Affiliations

                                                          (1)
                                                          Departamento de Genética, Laboratório de Genética Molecular e Bioinformática, e Laboratório de Genética de Abelhas, Faculdade de Medicina de Ribeirão Preto, Universidade de São Paulo
                                                          (2)
                                                          Centro de Terapia Celular e Centro Regional de Hemoterapia, Faculdade de Medicina de Ribeirão Preto, Universidade de São Paulo
                                                          (3)
                                                          Departamento de Biologia Celular e Molecular e Bioagentes Patogênicos, Faculdade de Medicina de Ribeirão Preto, Universidade de São Paulo
                                                          (4)
                                                          Ludwig Institute for Cancer Research
                                                          (5)
                                                          Departamento de Análises Clínicas, Toxicológicas e Bromatológicas, Faculdade de Ciências Farmacêuticas de Ribeirão Preto
                                                          (6)
                                                          Departamento de Biologia, Faculdade de Filosofia, Ciências e Letras, Universidade de São Paulo
                                                          (7)
                                                          Instituto de Genética e Bioquímica, Universidade Federal de Uberlândia
                                                          (8)
                                                          Laboratório de Neurociências (LIM-27), Instituto de Psiquiatria, Faculdade de Medicina - Universidade de São Paulo
                                                          (9)
                                                          Ludwig Institute for Cancer Research
                                                          (10)
                                                          Departamento de Clínica Médica, Laboratório de Hematologia, Faculdade de Medicina de Ribeirão Preto, Universidade de São Paulo

                                                          References

                                                          1. Whitfield CW, Band MR, Bonaldo MF, Kumar CG, Liu L, Pardinas J, Robertson HM, Soares B, Robinson GE:Annotated expressed sequence tags and cDNA microarrays for studies of brain and behaviour in the honey bee. Genome Res2002,12:555–566.View ArticlePubMed
                                                          2. Dias-Neto E, Correa RG, Verjovski-Almeida S, Briones MRS, Nagai MA, da Silva W, Zago MA, Bordin S, Costa FF, Goldman GH, Carvalho AF, Matsukuma A, Baia GS, Simpson DH, Brunstein A, de Oliveira PSL, Bucher P, Jongeneel CV, O'Hare MJ, Soares F, Brentani RR, Reis LFL, de Souza SJ, Simpson AJG:Shotgun sequencing of the human transcriptome with ORF expressed sequence tags. Proc Natl Acad Sci, USA2000,97:3491–3496.View ArticlePubMed
                                                          3. Camargo AA, Samaia HPB, Dias-Neto E, Simao DF, Migotto IA, Briones MRS, Costa FF, Nagai MA, Verjovski-Almeida S, Zago MA, Andrade LEC, Carrer H, El-Dorry HFA, Espreafico EM, Habr-Gama A, Giannella-Neto D, Goldman GH, Gruber A, Hackel C, Kimura ET, Maciel RMB, Marie SKN, Martins EAL, Nobrega MP, Paco-Larson ML, Pardini M, Pereira GG, Pesquero JB, Rodrigues V, Rogatto SR, da Silva I, Sogayar MC, Sonati MDF, Tajara EH, Valentini SR, Alberto FL, Amaral MEJ, Aneas I, Arnaldi LAT, de Assis AM, Bengtson MH, Bergamo NA, Bombonato V, de Camargo MER, Canevari RA, Carraro DM, Cerutti JM, Correa MLC, Correa RFR, Costa MCR, Curcio C, Hokama POM, Ferreira AJS, Furuzawa GK, Gushiken T, Ho PL, Kimura E, Krieger JE, Leite LCC, Majumder P, Marins M, Marques ER, Melo ASA, Melo M, Mestriner CA, Miracca EC, Miranda DC, Nascimento A, Nobrega FG, Ojopi EPB, Pandolfi JRC, Pessoa LG, Prevedel AC, Rahal P, Rainho CA, Reis EMR, Ribeiro ML, da Ros N, de Sa RG, Sales MM, Sant'anna SC, dos Santos ML, da Silva AM, da Silva NP, Silva WA, da Silveira RA, Sousa JF, Stecconi D, Tsukumo F, Valente V, Soares F, Moreira ES, Nunes DN, Correa RG, Zalcberg H, Carvalho AF, Reis LFL, Brentani RR, Simpson AJG, de Souza SJ:The contribution of 700,000 ORF sequence tags to the definition of the human transcriptome. Proc Natl Acad Sci, USA2001,98:12103–12108.View ArticlePubMed
                                                          4. Verjovski-Almeida S, DeMarco R, Martins EA, Guimaraes PE, Ojopi EP, Paquola AC, Piazza JP, Nishiyama MY Jr, Kitajima JP, Adamson RE, Ashton PD, Bonaldo MF, Coulson PS, Dillon GP, Farias LP, Gregorio SP, Ho PL, Leite RA, Malaquias LC, Marques RC, Miyasato PA, Nascimento AL, Ohlweiler FP, Reis EM, Ribeiro MA, Sa RG, Stukart GC, Soares MB, Gargioni C, Kawano T, Rodrigues V, Madeira AM, Wilson RA, Menck CF, Setubal JC, Leite LC, Dias-Neto E:Transcriptome analysis of the acoelomate human parasite Schistosoma mansoni. Nat Genet2003,35:148–157.View ArticlePubMed
                                                          5. Aguinaldo AMA, Turbeville JM, Linford LS, Rivera MC, Garey JR, Raff RA, Lake JA:Evidence for a clade of nematodes, arthropods and other moulting animals. Nature1997,387:489–493.View ArticlePubMed
                                                          6. Kucharski R, Maleszka R:Evaluation of differential gene expression during behavioral development in the honeybee using microarray and northern blots. [http://​genomebiology.​com/​2002/​3/​2/​research/​0007] Genome Biol2002,3.2:research0007.1–9.
                                                          7. Tsuchimoto M, Aoki M, Tajkada M, Kanou Y, Sasagawa H, Kitagawa Y, Kadowaki T:The changes of gene expression in honeybee (Apis mellifera) brains associated with ages. Zool Sci2004,21:23–28.View ArticlePubMed
                                                          8. Zdobnov EM, von Mering C, Letunic I, Torrents D, Suyama M, Copley RR, Christophides GK, Thomasova D, Holt RA, Subramanian GM, Mueller HM, Dimopoulos G, Law JH, Wells MA, Birney E, Charlab R, Halpern AL, Kokoza E, Kraft CL, Lai ZW, Lewis S, Louis C, Barillas-Mury C, Nusskern D, Rubin GM, Salzberg SL, Sutton GG, Topalis P, Wides R, Wincker P, Yandell M, Collins FH, Ribeiro J, Gelbart WM, Kafatos FC, Bork P:Comparative genome and proteome analysis of Anopheles gambiae and Drosophila melanogaster. Science2002,298:149–159.View ArticlePubMed
                                                          9. Kristensen NP:The phylogeny of hexapod "orders". A critical review. Z Zool Syst Evol Forsch1975,13:1–44.View Article
                                                          10. Crozier RH, Crozier YC:The mitochondrial genome of the honey bee Apis mellifera: Complete sequence and genome organization. Mol Biol Evol1993,6:399–411.
                                                          11. Lobo NF, Ton LQ, Hill CA, Emore C, Romero-Severson J, Hunt GJ, Collins FH:Genomic analysis in the sting–2 quantitative trait locus for defensive behavior in the honey bee, Apis mellifera. Genome Res2003,13:2588–2593.View ArticlePubMed
                                                          12. Evans JD, Gundersen-Rindal D:Beenomes to Bombyx: future directions in applied insect genomics. Genome Biol2003,4:107–110.View ArticlePubMed
                                                          13. Al-Shahrour F, Diaz-Uriarte R, Dopazo J:FatiGO: a web tool for finding significant associations of Gene Ontology terms with groups of genes. Bioinformatics2004,20:578–580.View ArticlePubMed

                                                          Copyright

                                                          © Nunes et al. 2004

                                                          This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://​creativecommons.​org/​licenses/​by/​2.​0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

                                                          Advertisement