Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 3 Primer sequences and conditions used for RT-PCR

From: A gene expression signature shared by human mature oocytes and embryonic stem cells

Gene Primer sequences (Forward, Reverse) Cycles MgCl2 (mM) Annealing Tm (°C) Product size (bp)
NANOG F: CAAAGGCAAACAACCCACTT
R: CTGGATGTTCTGG GTCTGGT
30 1.5 62 426
POU5F1/OCT4 F: GACAACAATGAGAACCTTCA
R: TTCTGGCGCCGGTTACAGAA
30 1.5 62 218
SOX2 F: ATGGACAGTTACGCGCACAT
R: GACTTGACCACCGAACCCAT
30 1.5 62 268
GAPDH F: AGCCACATCGCTCAGACACC
R: GTACTCAGCGGCCAGCATCG
30 1.5 62 238