Skip to main content

Advertisement

Table 3 Primer sequences and conditions used for RT-PCR

From: A gene expression signature shared by human mature oocytes and embryonic stem cells

Gene Primer sequences (Forward, Reverse) Cycles MgCl2 (mM) Annealing Tm (°C) Product size (bp)
NANOG F: CAAAGGCAAACAACCCACTT R: CTGGATGTTCTGG GTCTGGT 30 1.5 62 426
POU5F1/OCT4 F: GACAACAATGAGAACCTTCA R: TTCTGGCGCCGGTTACAGAA 30 1.5 62 218
SOX2 F: ATGGACAGTTACGCGCACAT R: GACTTGACCACCGAACCCAT 30 1.5 62 268
GAPDH F: AGCCACATCGCTCAGACACC R: GTACTCAGCGGCCAGCATCG 30 1.5 62 238