Skip to main content

Advertisement

Table 2 Characterization of 41 microsatellites isolated from cDNA of Asian seabass

From: A simple and efficient method for isolating polymorphic microsatellites from cDNA

Locus GenBank No Repeat motif Primer sequence (5'-3') Allele number Size range (bp) Ho He
LcaE072 (TG)18 CGCGGGGTTCCTCTTTCA 4 196–202 0.17 0.33*
EF210110   GCACCTGCACAGCTACACTCT     
LcaE073 (CA)8 CGGGTAGAAGACTGGAGGAGAG 9 298–338 0.71 0.79
EF210111   ACATTTTGCCACCATTTTGACTT     
LcaE74 (TG)9 TCTGGGGGCTGGTATATTTTCCTG 2 396–398 0.42 0.45
EF210112   ACACATTCCACCGCTGCCATTT     
LcaE075 (TG)11 CGCGGGATTGCCACTTTATTTT 5 226–234 0.38 0.56*
EF210113   GAGGATGGACTTCACAGGCACAGA     
LcaE076 (TG)28 GGGATCAGAACAAGAAAACAACC 20 117–185 0.91 0.92
EF210114   TAATCTAGGCACCAGGCTTCTTC     
LcaE077 (TG)7 CCTCACTGTGTCCAAGCATC 2 166–168 0.54 0.51
EF210115   TCCCCCTCAATAAGTAAAAATAG     
LcaE079 (CA)13 CCCGCCAAGGTCTCGTGTC 3 186–196 0.25 0.27
EF210116   CGGCAGCTGCGTGAATGTG     
LcaE080 (GA)12 GTCGCACCAGGTTAGGAGA 3 142–146 0.35 0.66*
EF210117   AAAAAGAGGAGCCACAGAGA     
LcaE201 (AG)13 GGCAAGCAGCCTCGGAGAAA 7 140–158 0.83 0.66
EF210118   TAACGGTTTTGGAAATTGAGATGC     
LcaE203 (CT)14 AGGCCCGAGGGTGAGCAG 6 262–278 0.54 0.83*
EF210119   ATGCAAAGGTGCGTGTATGATTTT     
LcaE205 (CA)12 CTGTGTCGCCTGTCGTAGTGACTG 6 195–213 0.46 0.61*
EF210120   CATTTGCTCCCATACTGGAACTGC     
LcaE206 (CA)8 GAAGCGGTCGAGGAAGGAATCC 3 132–136 0.41 0.46
EF210121   AGGCTTGGTACTTGCAGTGCTGTG     
LcaE208 (AC)10 GTCAGGCTGGCGACCATCTCA 3 176–180 0.44 0.46
EF210122   CAAATTCAAACCTTTATTAACACAACTA     
LcaE209 (AC)16 GTGTGAAACCAGGGAGCGTATG 7 208–240 0.58 0.77
EF210123   CCTTTGGGCAGTACTGTATTTTTC     
LcaE210 (TG)10 TCTGTACAAGTGGCACTCCATCAT 5 70–78 0.38 0.57*
EF210124   CAATCAAGCTTCACTGTTTTTACC     
LcaE211 (TG)20 TTTTTGAGGGGTACAATAAGTGTG 13 202–278 0.58 0.91*
EF210125   GAGAGCGGGATGAAGTATGAAG     
LcaE014 (TC)11 TGGAGAATGACACAAACGAGTAAA 6 256–266 0.58 0.76
FJ535708   ATTTGGGTGCATAGTGAGACAGTC     
LcaE015 (CA)16 AAGGCAAAGAGACACACACAC 5 153–167 0.68 0.66
FJ535709   CTCGATTCACTCTGCTCCATG     
LcaE016 (TC)8 AGCAGCGGAGGTGGAGTCA 4 258–266 0.87 0.66*
FJ535710   GGAGGGAGGGAGGGAGGAG     
LcaE020 (TG)10 ACCCCACGCAAGGAGAGGATAAT 3 191–195 0.35 0.36
FJ535711   GCTGGCAGGCGTTGTAATGAGTT     
LcaE021 (CA)7 CCTCAGTAATTTGGTCAAGAAACT 3 144–158 0.44 0.33
FJ535712   TGCAAGGACCTCTATGATACAAA     
LcaE022 (GA)10 ACTAACCCCGTTTGGCGTCCATCT 2 304–306 0.44 0.42
FJ535713   TTTGGCTTCGTTGTGATCATCAGC     
LcaE082 (TC)5–(TG)8 ATGGGGGTGGGGGTGTAACTTT 2 326–328 0.51 0.50
FJ535714   GCAGGGGCCCGGCTCATA     
LcaE083 (TG)23 GTCAAGGTAAACTGCCAATAG 3 154–158 0.47 0.38
FJ535715   AGAGAAAATGAGAGGAAGTTAGG     
LcaE098 (CA)12 GGGGGACAGTCAGGCAGATAGA 3 202–206 0.52 0.54
FJ535716   GCAGCAGATGCCTTTAACATTAGG     
LcaE100 (TG)7 CGCGGGTGTACACTTTGTATA 2 64–74 0.45 0.33
FJ535717   CTCAGTGTTTCTTTCTCAATGTCA     
LcaE102 (TG)10 CGCGGGGTTTAAGGAATGTAAG 3 176–180 0.45 0.38
FJ535718   AGGAAGGCCACGGTGATGG     
LcaE108 (TG)7 GAGCAGCTGGCCGGAAAGTAAAT 2 172–178 0.38 0.25
FJ535719   AGGCAGCAGAGGGAAAAGAAAATA     
LcaE111 (CA)7 AGTATACATGCCAGCAGTGTTACA 2 180–192 0.33 0.33
FJ535720   ATTTTTCCATCCTCGCTTCTC     
LcaE118 (CA)9 GGCCACGACGCGTAATCACTC 3 102–110 0.25 0.46*
FJ535721   TGCCCTGCTTCTTTTCCCTTCT     
LcaE120 (TC)9 ACCTCCCTCCAGACCATAAACAAC 3 144–160 0.33 0.35
FJ535722   AAGTCAGCCACGCTATACGCTTAG     
LcaE124 (TG)15 GGAAACAGGCTCCATCATCTTA 2 166–170 0.46 0.40
FJ535723   CACAACCGCTAAAGGCTATCA     
LcaE12 5 (TG)8 AAGCAAAGCAAAGCTCGGCTCTAT 5 212–220 0.63 0.76
FJ535724   TGAAGGTGCTTGGCGTCAGAT     
LcaE187 (TC)14 AAGCGCCTTTCTGTTCGTTATTC 10 146–178 0.79 0.86
FJ535725   TGAGGGGATCAGAAATGAAAACTC     
LcaE212 (GA)17 TGAGGCATTTCTGAGAACCAACAC 7 264–276 0.59 0.77*
FJ535726   AGGCTGGGCCAGATAAACACAA     
LcaE218 (TG)12 AACAAATGTGGCAAAAAGGTCTGC 4 280–288 0.13 0.20*
FJ535727   TTTGGGAAACTGCTCAACATCACC     
LcaE223 (CA)10 GACCGCCCCTTCCTCTACCTGAT 7 156–164 0.70 0.76
FJ535728   CAAACGCAAAGCAAACACCTGAAA     
LcaE241 (CA)16 GGAGGCCATGGAGAAGCAGATAG 6 199–217 0.50 0.72
FJ535729   CCTTTGGGCAGTACTGTATTTTTC     
LcaE246 (TG)7 CGCGGGTGAGACTATTACAGA 3 276–280 0.44 0.42
FJ535730   CAGTGCTGCGATATGTCTATTCAT     
LcaE248 (TG)12 CTCGGCCAGGTCTGATGAGT 8 169–187 0.83 0.46*
FJ535731   TAATACTGACGTCGCCTCGTTC     
LcaE250 (TG)7 GGCTCTCCCGTCTCCAGGTTT 3 94–104 0.42 0.51*
FJ535732   CTGCGCCCTCCCATCAGTG     
  1. H O , observed heterozygosity; He, expected heterozygosity; *HWE, P < 0.05