Skip to main content

Table 2 List of primers for qRT-PCR analysis of tissue-abundant genes.

From: Gene expression profiling in peanut using high density oligonucleotide microarrays

Gene name Accession # Primer name Primer sequence (5'-3') Primer effeciency Amplicon size (bp)
Glycinin precursor gi| 146771807 GLY F- TATGATGATGACGATCGACGACCACG 1.738 82
   GLY R- TGCATAGTGTTTCCTCCACTCCGT   
Late embryogenesis abundant protein 2 gi| 110810624 LEA2 F TAGTTCGGGTTGTAGTAGCAGGGT 1.831 99
   LEA2 R AAGGTTCCATCTTCTCGCCGATGT   
Protein disulfide-isomerase precursor gi| 56690261 PDI F AGGGTTCCGATCTGCTTCCTCTTT 1.823 96
   PDI R AAACTCCTTCTCTTTGGCCTCCGA   
Putative GPI anchored protein gi| 110811592 GPI-AP F AAATAGAGGACGAGCCATGCGAGA 1.603 89
   GPI-AP R AGGTTTGGAATGTTTGCGCTGGAG   
Plasmamembrane intrinsic protein 2 gi| 149221199 PIP2 F AAGACAAGCCCTGGGATGACCATT 1.832 96
   PIP2 R CTGCCCTCAAGATGAATTGGTGGT   
Transmembrane emp24 domain-containing protein 2 precursor gi| 149222425 emp24 F ACACGAATGAGAGCACACGAAAGC 1.812 88
   emp24 R ATGACCTGCAGTGCACTAACACCA   
Dessication-related protein PCC13-62 gi| 110811067 DRP F TGGAGAATCTCTACATCCCTCCT 1.854 99
   DRP R TCCCAGTGAGGCCAACATAAGGAA   
Lipoxygenase 4 gi| 126159580 LOX4 F TATTCAAGGGAGGGTGGTCTCACT 1.796 90
   LOX4 R AGGGATCCTGGCAAACAGGGAAAT