Skip to main content

Table 3 Q-PCR primer pairs used for the wheat control gene.

From: Comparative transcriptomics in the Triticeae

Gene Forward primer Reverse primer Product size (bp)
ELF1 CAGATTGGCAACGGCTACG CGGACAGCAAAACGACCAAG 227
GAPDH TTCAACATCATTCCAAGCAGCA CGTAACCCAAAATGCCCTTG 220
Cyclophilin CAAGCCGCTGCACTACAAGG AGGGGACGGTGCAGATGAA 227
Actin GACAATGGAACCGGAATGGTC GTGTGATGCCAGATTTTCTCCAT 236
  1. Primer sequence details for the control genes used in the Q-PCR verification of selected wheat expression profiles and the size of the corresponding RNA products.