Skip to main content

Table 3 Real time PCR primers

From: Gene expression responses in male fathead minnows exposed to binary mixtures of an estrogen and antiestrogen

GENE FWD PRIMER (5' – 3') REV PRIMER (5' – 3')
CYP 17 ACACAAGGTGGATTACAGTGATAACGT CTGCGTTTGGCCCTCAGA
3β-HSD ATGAGATGCCCTACCCAAAGAC CCCTTTACCTTTGTGCCATTG
11β-HSD GCATCGGCGAGCAGTTG CTCCTCGCCGTGATAACGA
INHB ACCACGCTACTCGGGATCAA CGGAGGGACTTCATGCTCTCT
CYP19A TGCTGACACATGCAGAAAAACTC CAGCTCTCCGTGGCTCTGA
P450scc CGACACCCGGACTTGCA CACGTCTCCTTTAGAGGTGATACG
StAR CTTGAACAGCAAACAGATGACCTT CTCCCCCATTTGTTCCATGT