Skip to main content

Table 7 New microsatellite markers developed from the chicken genome assembly (galGal3, http://genome.ucsc.edu/cgi-bin/hgGateway).

From: Microsatellite mapping of QTLs affecting resistance to coccidiosis (Eimeria tenella) in a Fayoumi × White Leghorn cross

Marker name Position (galGal3 assembly) Upper primer Lower primer PCR annealing T°
SEQALL0348 chr1:135392697-135392876 GCTCAGCACCTCCTCCTC AGAAAGCAGCCTCACAAAGC 55°C
SEQALL0349 chr1:135543677-135543882 AGGGTTTCCAAGTGGTGTTG ACCTTGCCTGAGACTGGTG 55°C
SEQALL0350 chr1:135576325-135576564 CGACAGATGGTCAAGAATGG ACACAGTTCTTCGCTGTACG 55°C
SEQALL0468 chr1:64162253-64162451 TTGCCATTCGAAACATCAAC GGACTCTGCTGTGCCAAATAC 50°C
SEQALL0469 chr1:64480773-64480997 TGAGATGATGAATGGCTTGG ATATGCAGCAGGGCTCATTC 58°C
SEQALL0470 chr1:72300927-72301126 CACAGGTCCACGAGAAAAGG TGCAGTCCTTCACATTCTGC 58°C
SEQALL0471 chr1:78494600-78494914 AGCATCATGACAGTCCAACC AGGCCAAATTGTCTCACTCG 58°C
SEQALL0472 chr6:24021693-24022070 ATCATGCGGCAGAAAAAGAG AAATCCATCAGCCTGACAGC 50°C
SEQALL0473 chr6:24772426-24772628 GAGAGGGAGGGAGATGAAGG GAAGAGCTCGTGCAAAAAGC 58°C
SEQALL0474 chr6:25154425-25154640 TAGGGTTTGGCTGTTGTCTG CATTTGGAAACCCAGAGCAG 58°C
SEQALL0475 chr15:4463535-4463868 ACAGGATGCTGCTGCTCAC AATGTTTCCCTTTCCCAACC 58°C
SEQALL0476 chr15:8651118-8651325 AGCCAAATCCTGTTTCATGC TGTCCTTTCTGGGAGAGACG 58°C
SEQALL0477 chr15:9172235-9172553 CATCCAAGTAACCCCACCTG TGTAAGGTGTAGGGCGTTGG 58°C
SEQALL0478 chr1:72181285-72181516 TGGCTTATGGCAACAAAAATC TGGCCGGTAGTGGATAAAAG 58°C
SEQALL0479 chr1:68536797-68537124 GATGTTCCTGGCACTTATAGGG TTTCCCTTTGTTTCTGCATCC 58°C
SEQALL0481 chr1:142664771-142665102 GCAGCTGCTGTTCCACAAG GCTCATTGCATTTTTGCTTTC 58°C
SEQALL0482 chr2:88572048-88572376 GGAAGTGTGTGTTATGGACTGG CTAGGCTGGAACTGGCAGTAG 58°C
SEQALL0483 chr2:90911596-90911826 TCTTGGAGATCACGGGAAAG TGCAACATCAGGACAAGAGG 58°C
SEQALL0484 chr6:5752041-5752395 CGAGTCTGCTGAATGGACAC GCGCAATTAATTCAGGAAGG 58°C
SEQALL0485 chr6:6245960-6246304 GACCACACAGTCACACGTCAG TCTGGAGGAAGCAATAAGAAGTG 58°C
SEQALL0486 chr6:25680338-25680656 TTCCCCAGGTGCTCTATCAG ACCATCGTCTCCTGCCATAG 58°C