Skip to main content

Table 3 Q-PCR primers with RSq and efficiency values

From: Surviving the cold: molecular analyses of insect cryoprotective dehydration in the Arctic springtail Megaphorura arctica (Tullberg)

Gene Name Clone ID Primer Sequence RSq % Efficiency
Housekeeping sequence     
Unknown sb_009_01G07 F: CTCGGACTCAGCCTGTCTA
R: ATAAATCGGACTTCCATTTCCA
0.982 95
Aquaporins     
AQP-A sb_006_02P03 F: ATGTTGTAGGAGGAAGCGTCA
R: ACAAACCGTCGTCTCGGTAG
0.991 115
AQP-B sb_006_05H07 F: ATTGGTGCTTGGTTGTTGAA
R: AATCCTGCTCCAGTGAATCC
0.996 98
AQP-C sb_006_08O08 F: TACCGTCGCTTCCATGATTA
R: CCCTTCACGTAGCTCCAGTT
0.995 105
Heat shock proteins     
sHSP sb_009_11D21 F: ACTCCACGCCAGCATTTCTTC
R: TCCAATTCTGTCCGCATTATTCC
0.991 111
HSP70 sb_009_03K12 F: CAAGGAGGTGGACAACAACAATC
R: CACAATCATTCAGCAGCAATAACAC
0.994 92
Antioxidants     
Superoxide dismutase sb_009_01L22 F: ACGAGAAGGTTGACGATTTGGG
R: ATTCCGCAGCCTAAACGAGAC
0.998 86
Catalase sb_006_03D21 F: CCCGAGATGGATTTATGAGTCC
R: CTAAGTACACAGAAGCCACACC
0.991 183
Glutathione-S-transferase sb_006_04F01 F: TGCTCCAAGTCGTGCCGTTC
R: GATGGCTCGTGACTCGCTTAG
0.988 153
Various     
Ferritin sb_006_04H15 F: GGAGGTCGTGTCGTTCTTCAG
R: CAGTTGTGGGTCACCATTTCG
0.991 94
Desaturase sb_006_09F19 F: GCTCCTGACCCGTAAACATCC
R: CCATGCTGCCAATAAACTTTCACC
0.996 105
Trehalose GO annotations     
Trehalose 6 phosphate synthase (1) sb_006_04P17 F: TGAATTGGACGATTACGCTGAAG
R: AGACTGCCCATTGCTTTGAGG
1.00 86
Trehalose 6 phosphate synthase (2) sb_006_06G01 F: GGATGGAATTACTGGAGCTTGG
R: GTGCTTGATGAGCTGTGAAACC
0.985 110
LATS tumour supressor sb_006_04E02 F: CGGGACGGACATATCAAACT
R: TGAGCAAGGCATCGTACATT
0.995 97
Serine/threonine protein kinase 38 sb_006_04N08 F: GACTGGTGGAGTCTGGGAGT
R: CAGTCCACGCTTTTGAAGAA
0.992 122
Protein kinase A cAMP dependant catalytic sub-unit sb_006_07A12 F: TCAAAGGTCGAACCTGGACT
R: AACCGTACTTTCCCTGCAAC
0.990 100
Trehalase precursor sb_006_01B14 F: CCGTAGATGGACTTCCTGGT
R: TGCCTGTCAGAACACACAAA
0.985 117
P70 ribosomal protein S6 kinase sb_006_01P13 F: GGGCGAGATGCTAATGAAAT
R: CCTTCGTGTGAGCAGTGTCT
0.991 115
Putative protein kinase DC2 sb_006_05C18 F: ATGGAGAATGGCACTGAGGAC
R: CTTAGGCGTCTTTGGTAAACATCC
0.995 99
Similar: serine/threonine protein kinase 6 (Aurora family kinase 1) sb_006_07A19 F: ACTTTGACATTGGGCGTCTC
R: CACCAGGGGCATATTCAAGA
0.934 180
Protein kinase C sb_008_03M09 F: ACTCCACGATGATGTGTTGTATCC
R: TCCAGAACCACTTCCTTGATTGC
0.995 80
cAMP dependant protein kinase C1 sb_009_02D08 F: CAACGTCATCTACCGTGACC
R: AAATACTCCGGTGTCCCACA
0.988 102