Skip to main content

Table 2 List of primers used for real-time PCR analysis.

From: Characterization of gene expression profiles for different types of mast cells pooled from mouse stomach subregions by an RNA amplification method

Gene Symbol Forward primer (5' -> 3') Reverse primer (5' -> 3')
Kit ATAGACCCGACGCAAC AATAAACGAGTCACGCT
Fcer1a GCCCCGTCTCCATTAG CAATAACCCCGTGTCC
Mcpt1 AAACAGTCATAAATGGCAAG GGGAACAAACCATCATCAC
Mcpt2 TTCATTGCCTAGTTCCTCT CTTTTCAGCTACTTGCTCT
Mcpt4 CCTTACATGGCCCATCT CTTCCCCGGCTTGATA
Cma2 GCGGAAATGCAAAGCC ACAGGGAACAGTCCATC
Anxa10 TACCCACAACTTCGGC GGCAAGTAGTGCTTTCT
Ctse GCAAGCCTATTGGCAG TGGCATCGTGTCGAGA
Fos TGTGTACTCCCGTGGT ACGAACAGGTAAGGTCC
Ptgr1 CATCGTGAATCGGTGG GCTAGGTCAAACGCAT
Cnn1 ACGGCCTACGGTACAC GGTACTCCGGGTTCAG
Ces3 AGTGATTGTGTCTCGAAG GTTCCCATTCCGAGCA
Cpe ACCGGAAGAGACTCTCA CCAGTAATCCCCATCCT
Notch4 CCCTTAAACTCGGTTGT GGTGCTTAATAAATAGTTGCC
28S rRNA CAGTACGAATACAGACCG GGCAACAACACATCATCAG