Skip to main content

Table 3 Primers used in qRT-PCR assays

From: Genome-wide expression profiling of in vivo- derived bloodstream parasite stages and dynamic analysis of mRNA alterations during synchronous differentiation in Trypanosoma brucei

Gene ID Forward primer Reverse primer
Tb10.26.0220 5' TCCAACCGATAACACGACAG 3' 5' CGATATGACCGACACGTCAC 3'
Tb927.7.7160 5' AGGCATCCATCGAGTACAGC 3' 5' TATCCTTCCGCAACACCTTC 3'
Tb10.6k15.3640 5' ACGGCCTCGTTGATACACTC 3' 5' CAACATTCCACCGACCATC 3'
Tb927.3.2710 5' GCAAGTCCATCACACAGGAG 3' 5' GAAGAGGCTACGGACACACC 3'
Tb927.1.4450 5' AGCAGCAGGTTATGGTGGAG 3' 5' ATACAACGATTCCGGTGAGC 3'
Tb10.389.0540 5' CCAGCCTTCTCAATCTCCAG 3' 5' GGCCACAGTTGGATAGCTTG 3'
Tb10.389.0650389.0650 5' ACGCTAGCACAACCAGAAGC 3' 5' GACCGACCAGGTCTTCTACG 3'
  1. A list of all primers used to analyse gene expression profiles by qRT-PCR is shown with their associated Gene ID.