Skip to main content

Table 3 Genetic linkage mapping of microsatellites isolated from BAC end sequences.

From: A first generation BAC-based physical map of the rainbow trout genome

Marker Clone Contig Chr. Forward/Reverse Primers GenBank
OMY4002 170E02 58 14 AGGTTATTTCCATTTCCCGC/GAGGAGTCCCAGAGGAAAGG GF100674
OMY4003 378C10 58 14 GACTTCTGCTCTGTCGGTCC/GACAGGTAGCCAAAACTCCG GF100675
OMY4005 116G20 260 2 TCATAAGTCATATGGTGACTATCATTT/GCAAATGCATTGACATCTCG GF100676
OMY4006 162L19 260 2 GATACACCCCTGCTGTTCGT/ACCCACCAAGCCACTCTCT GF100677
OMY4007 146D09 260 2 AACGCATAGGAGGGAGGATT/AAAATATTGTGGCCAGCAGC GF100678
OMY4008 198M04 84 18 ATGCTTTTGCAATTTCCTGG/ATGTTCATGCTGACCGACTG GF100698
OMY4009 227H04 791 22 CGCTGGAATGTTTTCATCTG/ATTTCACAAATGGCCAGGAG GF100679
OMY4010 383M11 930 11 TGATCATGGCACCCATACTG/TCACCCTGGTGGCCTACTAC GF100680
OMY4011 154C16 930 11 CAGTATGTCCTGTGAGGCCC/TCCACTTTAAGGGCATTTGG GF100681
OMY4012 194O09 100 27 AGCAAGCTCAATGAAGCACA/GAGCCCAGAGGTGAGATCAG GF100682
OMY4013 251I01 100 27 AGCGGACTGGGCTGTAATAA/ATGGACCAACTGAGCCTGAC GF100683
OMY4015 318K03 138 27 GTGGGCATTTTTGCTGACTT/CCGTTGATACATTTTGGCAG GF100684
OMY4017 300B08 138 1 TCATCTTCGACAGCATGGAG/GAAGGCCAAAGAAGCATGAA GF100685
OMY4018 207I23 138 1 CCTGTTTTGAAAATGGGACC/ACCAACCGCCATAGTAGCAG GF100686
OMY4020 377G20 168 10 TGTCCCTCAAAGTGCTACCC/CAGATGTGGGAACTTGAGCA GF100687
OMY4022 207O04 168 10 ACAAAGACCACAACGGCATT/TTGGCATTTACATATGTCCCC GF100688
OMY4023 241D02 336 3 ATCTCCAAGCCCTGAGGAAT/TTTTTGGTCCCCACAAGAAT GF100689
OMY4024 203O06 336 3 GAGCCAGTAATTCATTCGCC/GCAGGACAATCGTTTTAGGG GF100690
OMY4025 278E22 336 3 ATGACCCTGACGGGATGTTA/AGCTCCACACACAACACAGC GF100691
OMY4026 178K11 450 22 GTCGCAAAAGGCACTAAAGG/TGTGGCAGGTGCTGTTAGAG GF100692
OMY4027 204J15 450 22 ATGCCAAAGAAATGGACAGG/TGGCCTCCCTTGTCATTAAA GF100693
OMY4028 220L14 450 1 TCCCAGTGGATGGGACTTAG/GTGGGTGTCACATGTGTGGT GF100694
OMY4038 218N06 172 6 GGGGAAATTCAACCCACTTT/ATGGCGAATTGGCTAGACTG GF100695
OMY4039 275M02 172 6 ACTCTCCCCTGTCCTCCATT/CTAGTATCGACCCCTGCGAA GF100696
OMY4040 386B11 172 6 TGAAGGGGGCTGATTAGTTG/ACAGCGTTCCATAGCGAGAT GF100697
  1. All clones were from the 10X HindIII YY male Swanson doubled haploid BAC library (RT).