Skip to main content

Table 2 Sequences of primers used for qRT-PCR

From: Identification of expressed genes during compatible interaction between stripe rust (Puccinia striiformis) and wheat using a cDNA library

Unigenes ID Primer sequences(5'--3')
WRIS_671 Forward GGCTACGACTCCCTCAAGAAC
  Reverse TAGACTGGCACCGAGAACATC
WRIS_233 Forward GGGAGAGATACCAACGGAT
  Reverse CGCTTCTACAACGGAAACTA
WRIS_1264 Forward ACGCCCACGAATCTCAAG
  Reverse AGGCAAACACCAAGCACTG
WRIC_116 Forward CAGCCTGACTGGTATGGAAG
  Reverse ATGCTTCTGGCGGTCGTAG
WRIC_316 Forward TCTCTGTCCTTCTCAACTGGC
  Reverse TGGATCATAGCTTTGCATCC
WRIC_1608 Forward TCGCACCCATCAAGGAGCAT
  Reverse GCCACCCAACCAACAACCAC
WRIC_406 Forward CCATACCCACAGCGAGATT
  Reverse CCAGTTATTGCCGTTCACA
Wheat 18s RNA Forward CTGAGAAACGGCTACCACAT
  Reverse CCCAAGGTCCAACTACGAG
P. striiformis actin Forward CACACTTTCCACAACGAGC
  Reverse GGAGGCATACAAGGAGAGC