Skip to main content

Table 1 Identification of conserved DNA signals shared by different microsporidian species potentially implicated in ribosomal protein gene expression.

From: Identification of transcriptional signals in Encephalitozoon cuniculi widespread among Microsporidia phylum: support for accurate structural genome annotation

Product name E. cuniculi A. locustae E. bieneusi A. algerae N. ceranae
60S RIBOSOMAL PROTEIN L11 AAAAAAAATTT GATCCC CAAC* AAAAATTT ACCCTCCC AAAATTTTT ATGGT TGTTTAA AAAATTTTT AACCCC ACA AAATATTTTTTTTTATTTTTT ACCC TCTAAA
60S RIBOSOMAL PROTEIN L7A AAAAATTTT ACCC TCAA NS AAAAATTT ACCC TAAAT AAAAAAATTT ACCC AAATTTATTTTT CTACCCCC AAAA
40S RIBOSOMAL PROTEIN S17 AAAATTTTT CACCCC AAGA AAAAATTTTT AGCCC TCT AAAATTTT AAATCCTTACTTT AAAAATTTT GTACCC TCAT AACTATTTTT ACCC TTCAAA
60S RIBOSOMAL PROTEIN L9 AAAAAAATT GTTAAATACCAGAAGGACTTACCCC TT* AAAAAATTT GACCCC CG AAATTTTT ACCCT AAAATTTTTT ATCCC TT AATATTTTTTT ATCCCC TAA
60S RIBOSOMAL PROTEIN L24 AAATTTT GGATGTGCTAAGGG TAAA NS NS NS ATAATTTTTT ATACCC GTTAAA
40S RIBOSOMAL PROTEIN S8 AAAAAAATTT GCCC TGAA AAAAATTTTT ACCCC NS AAAATTTTTT AAAAATGACCC AATTTTTTTT ACCCC ACAA
60S RIBOSOMAL PROTEIN L35A AAAATTTTT GATCCC TCGTT NS NS NS AATTTTTTTT ATCCCC TAAA
  1. This table represents DNA sequences upstream the ATG codon for 7 ribosomal protein genes. isolated on the E. cuniculi chromosome 2 and their orthologs in A. locustae, E. bieneusi, A. algerae, and N. ceranae. DNA signals are highlighted as bold characters for AAATTT-like sequence and underlined characters for CCC- and GGG-like sequences. (NS indicates a Not already Sequenced gene and the star character stands for mispredicted start codon).