Skip to main content

Table 3 List of oligonucleotide primers used for RT, PCR and RACE-PCR experiments.

From: Identification of transcriptional signals in Encephalitozoon cuniculi widespread among Microsporidia phylum: support for accurate structural genome annotation

GENE ORF NUMBER PRIMER NAME SEQUENCE (5'-3') POSITION ON CHROMOSOME SEQUENCE
unk ECU02_0700 5'-unk ATGCCATCTCGGCACTTAGAAGGCTC complement (86499..86524)
   3'-unk GCGCTCCAGCTCATCAGCGGCGAG *# 86443..86466
htr ECU02_0710 5'-htr ACCTGTCCGTCCATACCACGTTGC 88604..88627
   3'-htr GATACCGACCTGGCGCTTGAACACG # complement (87230..87254)
h2a ECU02_0720 5'-h2a TGATCTCGCTGATTAGGTACATTAC 89217..89241
   3'-h2a GGACCAGGATGAGGATATCGAAGG complement (89268..89291)
pap ECU02_0730 5'-pap TCAAAGAACCCACGCTCCTGTAGG 90874..90897
   3'-pap GTCAAAGTTCGAGGCGGTTGACGAC complement (89812..89836)
ubi ECU02_0740i 5'ubi CTCGATACTGTCCGAAGGCTCGACT # 91300..91324
   3'-ubi AGTCGAGCCTTCGGACAGTATCGAG complement (91300..91324)
rib ECU02_0750i 5'-rib TGTCATGCTCTGACAGAACCGTCC *# complement (91758..91781)
   3'-rib AGAAGAAGGTATCCAAGCTGGCC 91698..91720
  1. For each gene two specific primers were designed. Each of them was used for RACE-PCR. * and # characters indicate the primers used for RT and PCR, respectively. ORF number are also indicated.