Skip to main content

Table 3 Primers used in qRT-PCR analysis to determine expression patterns of ESTs from the Puccinia striiformis f. sp. tritici haustorial library in various developmental and infection stages

From: Generation and analysis of expression sequence tags from haustoria of the wheat stripe rust fungus Puccinia striiformis f. sp. Tritici

Primer Sequence(5' to 3') Products size (bp)
RT-PSTha2a5-F TGAATGGGTCGGTTGCCACAGATA 180
RT-PSTha2a5-R GGCCCAAAGGGAATGGTCGAATTT  
RT-PSTha12j12-F GCTTCGTTCGGGATTCAAAGCAAC 138
RT-PSTha12j12-R ACATCTTGGGAACAGGCAGTTTCG  
RT-PSTha14i19-F AAGTGCTCGAATGGGTCCTACCTT 135
RT-PSTha14i19-R TGTGACGTTCACTTAGCCGATCCA  
RT-PSTha12h2-F ACGTCAGTCAAAGATGTCGGCGAA 120
RT-PSTha12h2-R TTCCTATCAATTAGCGCGGGAGCA  
RT-PSTha5a23-F TTCCTACTCTGGCGACCAACATCA 194
RT-PSTha5a23-R AAATCCGACTGACCGACATCCGTT  
RT-PSTha5a1-F ACCGTATCGAAAGTGGTGTACGCT 82
RT-PSTha5a1-R TGTCGTCCATTGGTCCCATAGTGT  
RT-PSTha12a4-F GTTCACCAAAGCCACCTTCAACCA 128
RT-PSTha12a4-R ATTAGACGGCGGCGTTCTTAGGAT  
RT-PSTha9F18-F ATTCGAGATTAACGCGACCAACGG 169
RT-PSTha9F18-R GAAAGGTCAATGACAACGGCGTCT  
RT-PSTha5G19-F AGGTCTCGATTACCTTCCGCTTCT 127
RT-PSTha5G19-R AAGAAAGATCGAAACCAGCACCAG  
RT-PSTha11n16-F TGGGCATCTTCAGCTAGTTGGACT 181
RT-PSTha11n16-R TCAACACATTCAGACCACCTCCGA  
RT-EF1-F TTCGCCGTCCGTGATATGAGACAA 159
RT-EF1-R ATGCGTATCATGGTGGTGGAGTGA  
RT-GAPDH-F CAACGCTAGCTGCACCACTA 161
RT-GAPDH-R TTCCACCTCTCCAGTCCTTG  
RT-TUB-F CCGATCAATTCACGGCCATGTTCA 174
RT-TUB-R AACCCTCTTCAACTTCCTCGTCGT  
RT-ACT-F TGTCGGGTGGAACGACCATGTATT 146
RT-ACT-R AGCCAAGATAGAACCACCGATCCA