Skip to main content

Table 4 Primers used to amplify fragments of Crassostrea hongkongensis mitochondrial genome.

From: "Tandem duplication-random loss" is not a real feature of oyster mitochondrial genomes

Order Primer name Sequence (5'-3') Length position Product size (bp)
1* HK-4343F TTAGAGTTCCGTTTCACCCG 20 4343 2470, 4617
  HK-6812R CTTTCGCTTCAATTTAGTTAGT 22 6812, 8959  
2* HK-6569F GGTTCTGGTATAATGTTAGCT 21 6569, 8716 824, 2971
  HK-7392R ATTACTCTCTTTTTACTCCC 20 7392, 9539  
3* HK-9412F CTAGGTCAGGTCGAAGTGCT 20 7265, 9412 1016, 3163
  HK-10427R AGAGCACAGGTGTTGGGTGA 20 10427  
4 HK-5807F GTCTCATAATCCGAAAGTGGTT 22 5807 2658
  HK-8464R CTTATACTTGGGCTACTTTCTT 22 8464  
5 HK-8138F GGTGCTCACTAAATCAGTATGT 22 8138 1905
  HK-10043R ATGAAGATAGTGACGGAAACCC 22 10043  
  1. *Primer pairs from Yu et al. (2008). Because one or both of the primers are located in the duplicated rrnS gene, two fragments are expected but only the shorter one is actually amplified.