Skip to main content

Table 1 The designed primers for CYP2D6 analysis obtained from RExPrimer

From: RExPrimer: an integrated primer designing tool increases PCR effectiveness by avoiding 3' SNP-in-primer and mis-priming from structural variation

Name Sequence 5' → 3' Purpose
CYP2D6_1F GGCCTACCCTGGGTAAGGGCCTGGAGCAGGA whole gene amplification
CYP2D6_1R CTCAGCCTCAACGTACCCCTGTCTCAAATGCG  
CYP2D6_2F GAGACTCCTCGGTCTCTCG penta-plex PCR
CYP2D6_2R TAATGCCTTCATGGCCACGCG  
CYP2D6_3F AGGCCTTCCTGGCAGAGATGAAG penta-plex PCR
CYP2D6_3R CCCCTGCACTGTTTCCCAGA  
CYP2D6_4F CCAGCCACCATGGTGTCTTTG penta-plex PCR
CYP2D6_4R GCCTCAACGTACCCCTGTCTC  
DMD_F TTGTCGGTCTCCTGCTGGTCAGTG one-copy internal standard in penta-plex PCR
DMD_R CAAAGCCCTCACTCAAACATGAAGC  
LDL_F TACAAGTGCCAGTGTGAGGAAG two-copy internal standard in penta-plex PCR
LDL_R GTGCAAAGTTCAGAGGATGAAACT  
  1. Rows 2-6 represent semiquantitative analysis of CNV