Skip to main content

Advertisement

Table 1 Expression of mature- and pre-miRNAs in Vitis vinifera

From: Erratum to: High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera

miRNA Sequence Expression data miRNA Sequence Expression data
   A B C D    A B C D
MIR156A UGACAGAAGAGAGGGAGCAC 0* ____ N __I___ MIR171G UUGAGCCGAACCAAUAUCACC 0 __RC N R*L*I*___
MIR156B UGACAGAAGAGAGUGAGCAC 34 ___C N ______ MIR172A UGAGAAUCUUGAUGAUGCUGCAUC 4 _S_C N ______
MIR156C UGACAGAAGAGAGUGAGCAC 34 ____ N ______ MIR172B UGAGAAUCUUGAUGAUGCUGCAUC 4 ____ N ______
MIR156D UGACAGAAGAGAGUGAGCAC 34* LSRC N ______ MIR172D AGAAUCUUGAUGAUGCUGCAU 0 ____ N _LIBgBv_
MIR156E UGACAGAGGAGAGUGAGCAC 0 ____ N ______ MIR172C GGAAUCUUGAUGAUGCUGCAG 0 ____ N _LIBgBv_
MIR156F UUGACAGAAGAUAGAGAGCAC 926 _S__ N RLIBgBvBm MIR319B UUGGACUGAAGGGAGCUCCCU 1 ____ N RLIBgBvBm
MIR156G UUGACAGAAGAUAGAGAGCAC 923* LS_C N RLIBgBvBm* MIR319C UUGGACUGAAGGGAGCUCCCU 1 _S__ N RLIBgBvBm
MIR156I UUGACAGAAGAUAGAGAGCAC 923* _S__ N RLIBg*BvBm MIR319E UUUGGACUGAAGGGAGCUCCU 0 _S_C Y RLIBgBvBm
MIR156H UGACAGAAGAGAGAGAGCAU 0 LS__ Y ______ MIR319G UUGGACUGAAGGGAGCUCCCA 2 ___C N RLIBgBvBm
MIR159A CUUGGAGUGAAGGGAGCUCUC 0 ____ N RLIBgBvBm MIR319F UUGGACUGAAGGGAGCUCCCU 1 _S__ N RLI*BgBv*Bm*
MIR159B CUUGGAGUGAAGGGAGCUCUC 0 ____ N RLIBgBvBm MIR390 AAGCUCAGGAGGGAUAGCGCC 1 _S__ N RLIBgBvBm
MIR159C UUUGGAUUGAAGGGAGCUCUA 173 LSRC N RLIBgBvBm MIR393A UCCAAAGGGAUCGCAUUGAUC 1 ____ Y RLIBgBvBm
MIR160A UGCCUGGCUCCCUGAAUGCCAUC 1 ____ N RLI*BgBv*Bm* MIR393B UCCAAAGGGAUCGCAUUGAUC 1 LS__ Y RLIBgBvBm
MIR160B UGCCUGGCUCCCUGAAUGCCAUC 1 ____ Y RLIBgBvBm MIR394A UUGGCAUUCUGUCCACCUCCAU 1 _S__ N ______
MIR160E UGCCUGGCUCCCUGAAUGCCAUC 1 ____ Y RLIBgBvBm MIR394B UUGGCAUUCUGUCCACCUCC 0 LS_C N ______
MIR160C UGCCUGGCUCCCUGUAUGCCA 2* _SRC N RLIBgBvBm* MIR394C UUGGCAUUCUGUCCACCUCCAU 2 ____ N ______
MIR160D UGCCUGGCUCCCUGUAUGCCA 2 ____ N RLIBgBvBm MIR395A CUGAAGUGUUUGGGGGAACUC 0 ____ N RLIBgBvBm
MIR160F UGCCUGGCUCCCUGUAUGCCA 2 ____ N RL*IBg*Bv*Bm MIR395B CUGAAGUGUUUGGGGGAACUC 0 ____ N RLIBgBvBm
MIR162 UCGAUAAACCUCUGCAUCCAG 5 LS_C Y RLIBgBvBm MIR395C CUGAAGUGUUUGGGGGAACUC 0 ____ N RLI*BgBvBm
MIR164A UGGAGAAGCAGGGCACGUGCA 7 ____ N RLIBg__ MIR395D CUGAAGUGUUUGGGGGAACUC 0 ____ N RLIBgBvBm
MIR164C UGGAGAAGCAGGGCACGUGCA 7 L___ N RLIBg__ MIR395E CUGAAGUGUUUGGGGGAACUC 0 ____ N RLIBgBvBm
MIR164D UGGAGAAGCAGGGCACGUGCA 7 ____ N RLIBg__ MIR395F CUGAAGUGUUUGGGGGAACUC 0 ____ N RLIBgBvBm
MIR164B UGGAGAAGCAGGGCACAUGCU 0 ____ N _LI*Bg__ MIR395L CUGAAGUGUUUGGGGGAACUC 0 ____ N RLIBgBvBm
MIR166A UCGGACCAGGCUUCAUUCC 43* LSRC Y RLIBgBvBm MIR395M CUGAAGUGUUUGGGGGAACUC 0 ____ N RLIBgBvBm
MIR166B UCGGACCAGGCUUCAUUCC 43* LS__ N RLIBgBvBm MIR395G CUGAAGUGUUUGGGGGAACUC 0 ____ N RLIBgBvBm
MIR166C UCGGACCAGGCUUCAUUCCCC 63* LSRC N RLIBgBvBm MIR395H CUGAAGUGUUUGGGGGAACUC 0 ____ N RLIBgBvBm
MIR166D UCGGACCAGGCUUCAUUCCCC 63 _S__ N RLIBgBvBm MIR395I CUGAAGUGUUUGGGGGAACUC 0 ____ N RLIBgBvBm
MIR166E UCGGACCAGGCUUCAUUCCCC 63* _SRC N R*LI*Bg*Bv*Bm* MIR395J CUGAAGUGUUUGGGGGAACUC 0 _S__ N RLIBgBvBm
MIR166F UCGGACCAGGCUUCAUUCCCC 63* ____ N RLIBgBvBm MIR395K CUGAAGUGUUUGGGGGAACUC 0 ____ N RLIBgBvBm
MIR166G UCGGACCAGGCUUCAUUCCCC 63* ____ N RLIBgBvBm* MIR395N CUGAAGAGUCUGGAGGAACUC 0 ____ N _L____
MIR166H UCGGACCAGGCUUCAUUCCCC 63 _S_C N RLIBgBvBm MIR396B UUCCACAGCUUUCUUGAACU 0* LS_C N RL_Bg__
MIR167A UGAAGCUGCCAGCAUGAUCUG 0* L_RC N RLIBgBvBm MIR396A UUCCACAGCUUUCUUGAACUA 0 _S__ N RL_Bg__
MIR167B UGAAGCUGCCAGCAUGAUCUA 25 L__C Y RL*IBg*BvBm MIR396C UUCCACAGCUUUCUUGAACUG 0 ____ N RL_Bg__
MIR167C UGAAGCUGCCAGCAUGAUCUC 0 ____ N RLIBgBvBm MIR396D UUCCACAGCUUUCUUGAACUG 0 _S_C N RL_Bg__
MIR167D UGAAGCUGCCAGCAUGAUCUA 6 LS__ N RLIBgBvBm MIR397A UCAUUGAGUGCAGCGUUGAUG 2* LS_C N R__Bg__
MIR167E UGAAGCUGCCAGCAUGAUCUA 30 ____ N RLIBgBvBm MIR397B UCAUUGAGUGCAGCGUUGAUG 2* ____ N R__Bg__
MIR168 UCGCUUGGUGCAGGUCGGGAA 3* LSRC Y RLIBgBvBm MIR398A UGUGUUCUCAGGUCACCCCUU 0 _SRC N RL_Bg__
MIR169B UGAGCCAAGGAUGGCUUGCCG 0 ____ N _L__BvBm MIR398B UGUGUUCUCAGGUCGCCCCUG 2 LSRC N R__Bg__
MIR169H UGAGCCAAGGAUGGCUUGCCG 0 ____ N _L__ BvBm MIR398C UGUGUUCUCAGGUCGCCCCUG 2* LSRC N R__Bg__
MIR169A CAGCCAAGGAUGACUUGCCGG 0 ____ N _LIBgBvBm MIR399A UGCCAAAGGAGAAUUGCCCUG 0 L___ N R_I___
MIR169C CAGCCAAGGAUGACUUGCCGG 0 ____ N _LIBgBvBm MIR399H UGCCAAAGGAGAAUUGCCCUG 0 L___ N R_I___
MIR169J CAGCCAAGGAUGACUUGCCGG 0 ____ N _LIBgBvBm MIR399B UGCCAAAGGAGAGUUGCCCUG 0 ____ N R__Bg_Bm
MIR169K CAGCCAAGGAUGACUUGCCGG 0 ____ N _LIBgBvBm MIR399C UGCCAAAGGAGAGUUGCCCUG 0 ____ N R__Bg_Bm
MIR169S CAGCCAAGGAUGACUUGCCGG 0 ____ N _LI*BgBvBm MIR399I CGCCAAAGGAGAGUUGCCCUG 1 L_RC N R__Bg_Bm
MIR169W CAGCCAAGGAUGACUUGCCGG 0 ____ N _LIBgBvBm MIR399D UGCCAAAGGAGAUUUGCUCGU 0 ____ N ______
MIR169L GAGCCAAGGAUGACUUGCCGU 0 ____ N _LIBgBvBm MIR399E UGCCAAAGGAGAUUUGCCCGG 0 ___C N ______
MIR169M GAGCCAAGGAUGACUUGCCGG 0 ____ N _LI*BgBv*Bm* MIR399F UGCCGAAGGAGAUUUGUCCUG 0 ____ N ______
MIR169N GAGCCAAGGAUGACUUGCCGG 0 ____ N _L*I*Bg*Bv*Bm* MIR399G UGCCAAAGGAGAUUUGCCCCU 0 ____ N R_I__Bm
MIR169O GAGCCAAGGAUGACUUGCCGC 0 ____ N _LIBgBvBm MIR403A UUAGAUUCACGCACAAACUCG 4* ____ N RLIBgBvBm
MIR169P GAGCCAAGGAUGACUUGCCGG 0 ____ N _LIBgBvBm MIR403B UUAGAUUCACGCACAAACUCG 4 ____ N RLIBgBvBm
MIR169Q GAGCCAAGGAUGACUUGCCGG 0 ____ N _LIBgBvBm MIR403C UUAGAUUCACGCACAAACUCG 4* ___C N RLI*BgBvBm*
MIR169E UAGCCAAGGAUGACUUGCCUGC 1 L___ N _LIBgBvBm MIR403D UUAGAUUCACGCACAAACUCG 4 ____ N RLIBgBvBm
MIR169F CAGCCAAGGAUGACUUGCCGA 0 ___C N _LIBgBvBm* MIR403E UUAGAUUCACGCACAAACUCG 4* ____ N RLIBgBvBm
MIR169G CAGCCAAGGAUGACUUGCCGA 0 _S__ N _LIBgBvBm MIR403F UUAGAUUCACGCACAAACUCG 4* _SRC N RLIBgBvBm
MIR169R UGAGUCAAGGAUGACUUGCCG 0 ____ N _LI*BgBv*Bm* MIR408 AUGCACUGCCUCUUCCCUGGC 6* LSRC Y RLIBgBvBm
MIR169T CGAGUCAAGGAUGACUUGCCG 0 ____ N _L*I*Bg*Bv*Bm* MIR477 AUCUCCCUCAAAGGCUUCCAA 0 ____ N ___BgBvBm
MIR169U UGAGUCAAGGAUGACUUGCCG 0 ____ N _L*I*Bg*Bv*Bm* MIR479 UGUGGUAUUGGUUCGGCUCAUC 2* ____ N ______
MIR169V aAGCCAAGGAUGAAUUGCCGG 0 ____ N __IBg__ MIR482 UCUUUCCUACUCCUCCCAUUCC 5* LSRC Y ______
MIR169X UAGCCAAGGAUGACUUGCCUA 0 ____ Y _LIBgBvBm MIR535A UGACAACGAGAGAGAGCACGC 42* ____ Y RLIBgBvBm
MIR169Y UAGCGAAGGAUGACUUGCCUA 0 ____ N __I___ MIR535B UGACAACGAGAGAGAGCACGC 80* ____ Y RLIBgBvBm
MIR169I GAGCCAAGGAUGACUGGCCGU 0 ____ N _L_Bg__ MIR535C UGACAACGAGAGAGAGCACGC 80* ____ Y RLI*BgBv*Bm
MIR169D CAGCCAAGAAUGAUUUGCCGG 0 ____ N ______ MIR535D UGACAACGAGAGAGAGCACGC 80* ____ Y RLIBgBvBm
MIR171B UGAUUGAGCCGCGUCAAUAUC 0 ____ N R_____ MIR535E UGACAACGAGAGAGAGCACGC 80* ____ Y RLIBgBvBm
MIR171C UGAUUGAGCCGUGCCAAUAUC 4 ____ N RLIBg__ MIR828A UCUUGCUCAAAUGAGUAUUCCA 0 ____ N ______
MIR171D UGAUUGAGCCGUGCCAAUAUC 4 ____ N RLIBg__ MIR828B UCUUGCUCAAAUGAGUGUUCCA 0 ____ N ______
MIR171A UGAUUGAGCCGUGCCAAUAUC 4 _SRC Y RLIBg__ MIR845A UAGCUCUGAUACCAAUUGAUA 0 ____ N ______
MIR171I UGAUUGAGCCGUGCCAAUAUC 4 ____ N RLIBg__ MIR845B UAGCUCUGAUACCAAUUGAUA 0 ____ N ______
MIR171E UGAUUGAGCCGCGCCAAUAUC 0 ___C N RLI*BgBv*Bm* MIR845C AGGCUCUGAUACCAAUUGAUG 0 ____ N ______
MIR171H UGGUUGAGCCGCGCCAAUAUC 0 ____ N RLIBgBvBm MIR845D UGGCUCUGAUACCAAUUGAUG 0 ____ N ______
MIR171F UUGAGCCGCGCCAAUAUCACU 0 _S__ N RLIBgBv_ MIR845E UGGCUCUGAUACCAAUUGAUG 0 ____ N ______
  1. For each predicted pre-miRNA the table reports: the mature sequence, the number of perfect matching or oligoadenylated short RNA reads observed in leaf, asterisks indicate that corresponding miRNA* sequences were also recovered by deep sequencing (column A), tissues in which significant expression of the precursor was observed by Illumina whole transcriptome sequencing (column B, where L = leaf, R = root, S = stem, C = callus), the presence of 454 reads including the precursor sequence in leaf (column C, where Y = yes, N = no), and tissues where the Combimatrix oligoarray showed significant expression of the mature sequence (column D, where L = leaf, I = inflorescence, R = root, Bg = immature berry, Bv = veraison, Bm = mature berry). Asterisks indicate signal detected for precursor in that tissue. Mature miRNAs are ordered to reflect expected cases of crosshybridization for oligonucleotide arrays. For all microRNAs, chromosome, strand and coordinates of the precursor miRNA are provided (scaffold coordinates indicate that the miRNA was situated on a scaffold not incorporated into the 8.4× genome assembly).