Skip to main content

Table 3 Primer sequences utilized for quantitative real-time PCR (qRT-PCR).

From: Transcriptional and pathway analysis in the hypothalamus of newly hatched chicks during fasting and delayed feeding

RIGG# Gene Name ENSEMBL ID
(ENSGALG0000_)
Forward Sequence (5'-3') Reverse Sequence (3'-5')
12704 SSTR5 005258 AACAGCTGTGCCAACCCTAT CCTCTACACCATTGCCCTTT
15132 NPY5R 09499 TTCCACATTGTGACGGATTT AGCAGCAGGACATCATACCA
15762 DIO2 10520 ACTGTTTGAGGGCGCTAAACC AAACACTAGCCCTCCAGAATACCTT
15385 COCH 09920 TAGAGGACCTGCTGTTGCTG GGTTCAGAGGCCATGTCTTT
17342 CYP19A1 13294 GTGCTTTTGGATGCAGTACC CCTTTCATTCCCAGCCTTTA
00156 FKBP5 00947 TTTGCCAAGTTTGCTGAGAGG CCTCTGTCTCTTTGCCTTCATCA
19293 CYP39A1 16710 GTGCTTTTGGATGCAGTACC CCTTTCATTCCCAGCCTTTA
19221 POMC 16600 CGCTACGGCGGCTTCA TCTTGTAGGCGCTTTTGACGAT
18192 FABP7 14866 AAATGGGATGGCAAAGAGAC TTCTCATAGTGGCGAACAGC
16984 SALL3 12657 CACCCATACTGGTGAAAAACC TTATTCCACATGTGCGTTCC
08723 PKCi 09364 GCAATGTTGATTGGGATCTG TTGGTGAACTGGGAATCAAA
11322 ADRA2C 02808 CCTTCAACCCCCTGATCTAC CCGTTGGCATACATCTTCAG
02139 GHRH 03842 AGGAGAAGGGGTGCACAA CTCCCAAGAAGTCCCTCAGT
14532 TRH 08490 ATGCTTCAATCTGTCCTCAAGA GTCTCCAAAAGATGCTTTTTCC
17124 MC4R 12907 CGGGAGGCTGCTATGAACAA AGCTGATGATGCCCAGAGTCA
14136 FGF16 07806 ACGAGAGAGGCGAGCTGTAT AGAGTGTTGAGGCGTACGTG
13934 HBA1 07468 TGGACCCTGTCAACTTCAAA GAACTTGTCCAGGGAAGCAT
  CRH 15521 CATCTCCCTGGACCTGACTT CCATCAGTTTCCTGTTGCTG
  NPY 10983 GGGAAAGCACAGAAAACATTCC AAATCCCATCACCACATCGAA
  LEPR 11058 TTCCAAACCCCAAGAATTGCT CAAATGACATTGCTTCAGGGTG
  AGRP 02244 AAGTCTGGCCTGGGAAGAG CCCCCTGCAGAAGATGAG