Skip to main content

Advertisement

Table 2 Oligonucleotide sequences.

From: Complementary transcriptomic, lipidomic, and targeted functional genetic analyses in cultured Drosophila cells highlight the role of glycerophospholipid metabolism in Flock House virus RNA replication

Name/description Sequence (5' → 3')
Cct1-for *GAGATGGCCGAGAAGTTGAG
Cct1-rev *GGATTCCCTCGATTCTCACA
Cct2-for *ACTTGGGCCTGAGACTGCTA
Cct2-rev *CTTTCGGCATTCTGTCCATT
Act5C-for ATGTGTGACGAAGAAGTTGCT
Act5C-rev GTCCCAGTTGGTCACGATACC
FHV1-RNAi-for TAATACGACTCACTATAGGG ATGACTCTAAAAGTTATTC
FHV1-RNAi-rev TAATACGACTCACTATAGGG TCTGCTAGCGATAAAC
S2-RNAi-T7 TAATACGACTCACTATAGGG AGACCACGGGCGGGT
  1. The T7 RNA polymerase promoter is in bold italics type for FHV1 RNAi-for, FHV1 RNAi-rev, and S2-RNAi-T7 oligonucleotides, and was also added to the 5' end of the Cct1 and Cct2 oligonucleotides (asterisks) that were used to generate dsRNAs.