Skip to main content

Table 2 Quantitative (Real-Time) RT-PCR information

From: Functional genomics of mountain pine beetle (Dendroctonus ponderosae) midguts and fat bodies

Feature Tentative I.D. Primer pair (Forward/Reverse) Amplicon Length (bp) Tm (°C) Amplification Efficiency (%)
Contig1127 P450 (CYP6) ACTTCCCGCTGGATACAGACAT/GGATAAGACATCGTCTGGATTGTTG 101 76 90.91
Contig1103 P450 (CYP6) AATGACTGCTTCGGTGCTGAA/ATTCCATGTCCCTACGATTGTGT 113 79 90.80
DPG001G12 P450 (CYP4) CCGTAATCCCACAATGTTCGA/CCAAGGCAAAGTCTAGGTCCAT 117 78 92.41
Contig64 P450 (CYP6) GCAAGAGGAATCAACCGCTAA/CTATGCTGCCTCAGCTCGTTATT 128 79 86.46
Contig608 P450 (CYP6CR1) GAGGAACCACATAGTTGTCATGGA/CAAAAGGGAGGCGGATGTTA 141 73 93.3
Contig160 P450 (CYP6) AATGATTGCTTCGGCACTGAA/GGATTTGAGTAATTCCATGCTCCTA 113 76 105.64
MPB029F09 P450 (CYP6) ACTGGTAACGGACTACGATCACTTT/TGAACGCAATACTTTCCATTCG 115 75 89.16
MPB019E07 HMGR CCAATCACCCGTGGGAAGT/CGAAGTGGAGGTTGCTGTTCA 82 81 95.45
Contig126 GGPPS TGAACGTGCCCAAAGAGAATT/TCGGCTAGTTTAGCTCGGATATTT 101 77 92.12