Skip to main content

Table 5 Sequence of gene-specific primers used for real-time PCR analysis.

From: Differential transcript expression between the microfilariae of the filarial nematodes, Brugia malayi and B. pahangi

Pub locus Forward primer Reverse primer
Bm1_49585 GACCGAAACAAGAAAGGAAGCCGA ACTTTCATCATCATTATGTCGTCGCG
Bm1_11050 GATGAAACGTTTCATGAGATG GATAATCCTCCAAAACTACCG
Bm1_02070 AATAATTGGATTTCGAGTGAGAC TTCATGCATAATTACCAGTTTCG
Bm1_28420 AAGGCTTCGATATGTTTCCATC CTAACCACTAGTACATATTGTCT
Bm1_42865 AAACATGCAGTTAATGCACGAG TGCTTGCAATTCATTCCTCACT
Bm1_19100 GCCACAAGGTATGCAACCACA GTGTCTGCGTGGGTGGTAAC
Bm1_25950a GCTAACTTCAATGCACTTAGTG AAATAAGAAACAACGTTTGATACAG
Bm1_01300a CAATTTTCAGACTCAATCTACTG AGGTAAGTATTTGTCAACGTTTG
Bm1_44655a GTACGAAAGCAAGGATTCTGCT CAGAATACTTTGTAGGTATCATTC
Bm1_50670a GTATTAGCTCAAGCAATGGAAG CTAACTACTATCATCACTATTATC
bm.02018ab AGAATCAAATGTCCAGGAAG CTGTGAGAGGAAGATAGTC
BMX9555b TTGATGTAGATGCTTTAACAAGTGCTGCTC AAGAAATTGTCGACAAAGTCCGCAAG
BMX10185b CCGCACAACAATCCTCACTTGCT TGTGTTACTGCTATTAACATCCTCACTGCC
  1. Each primer is written in the 5' to 3' direction.
  2. a Indicates the genes whose probe regions were amplified and sequenced using the primers shown.
  3. b Indicates the probes whose primers were used to determine a suitable endogenous control for real-time PCR analysis.