Skip to main content

Table 2 Porcine miRNAs with hairpin forming precursors and genomic locations.

From: Deciphering the porcine intestinal microRNA transcriptome

conserved miRBase 14.0 internal ID mature sequence precursor sequence mfe (kcal/mol) gen. location subject ID start end
Genomic duplications
ssc-miR-194 MDM9 UGUAACAGCGACUCCAUGUGGAC UGUAACAGCGACUCCAUGUGGACUGUGCCCCAAUUUCCAGUGGAGAUGCUGUUACCUU -37.4 X emb|FP565626.1| 43462 43519
      10 emb|CU466937.2| 6280 6223
ssc-miR-365-1 MDM48 UAAUGCCCCUAAAAAUCCUUAU GAGGGACUUUUGGGGGCAGAUGCGUUUCCAUUCCACUAUCAUAAUGCCCCUAAAAAUCCUUAU -33.8 3 emb|CU896561.2| 167752 167814
ssc-miR-365-2 MDM45 UAAUGCCCCUAAAAAUCCUUAU GAGGGACUUUCAGGGGCAGCUGUGUUUUCUGACUCAGUCAUAAUGCCCCUAAAAAUCCUUAU -35 12 emb|FP016089.2| 194688 194749
  MDM123 AAACGAUGAUGGAAGGUGCUGAGGA CUCUCUGGUCCCUUCUCUCCCCUCUUCAUGGUUGACAGCAACCCCAGAAACGAUGAUGGAAGGUGCUGAGGA -35.4 2 emb|CU896534.2| 31001 30933
  MDM266 AAACGAUGAUGGAAGGUGCUGAGGA AAACGAUGAUGGAAGGUGCUGAGGAAGGGGUGCUAAUGUCCUAGCGUUUCCUCCUUCCAUUGUUAGGAGGC -32.7 ND ND ND ND
  MDM208 UCUGGCUGUGGUGUAGGCCGU GGAUCUGCGCAUUGCCGCGAGCUGCAGUGUAGGUCACAGAUGUGGCUCAGAUCCAGCAUUGCUCUGGCUGUGGUGUAGGCCGU -40.3 16 emb|CU571054.2| 59166 59247
  MDM116 UCUGGCUGUGGUGUAGGCCGUC AGGUCACAAACACGGCUCAGAUCUGAUGUUGCUCUGGCUGUGGUGUAGGCCGUC -41 13 emb|CU582976.2| 156369 156318
mmu-miR-1896 MDM214 AUGGGUGAGGAGUGUUGUGUAUAUA AUGGGUGAGGAGUGUUGUGUAUAUAUAUUUGUGUGUUUGUAUAUACACAUCUCAAAGCUUAUUU -27.2 6 emb|FP236156.2| 77046 76983
      16 emb|FP085480.3| 108843 108906
hsa-miR-1977 MDM262 GACUUGGAAUUAGUAGGGUGCUUA GACUUGGAAUUAGUAGGGUGCUUAGAACAGUGCCUGAUACAUAGUUUCACAA -26.2 4 emb|FP236645.1| 179755 179704
      14 emb|CT737346.2| 42310 42361
  MDM284 GCCGCGGCGUCCGGGCUG GCCGCGGCGUCCGGGCUGUGUCCGCCCUGGCGGGCGCGCGGGGGCGGGAAGGCGCGGGCUGUCAAGGGCGCUGCGGCAG -61 X emb|CU466457.2| 83369 83334
      13 emb|CU582896.2| 20953 20988
Genomic clusterings
ssc-miR-215 MDM1 UGACCUAUGAAUUGACAGACA UGACCUAUGAAUUGACAGACAAUGUGGCUAAAUCUGUCUGUCAUUUCUGUAGGCCAAU -29.8 X & 10 emb|FP565626.1| 43758 43815
ssc-miR-194 MDM9 UGUAACAGCGACUCCAUGUGGAC UGUAACAGCGACUCCAUGUGGACUGUGCCCCAAUUUCCAGUGGAGAUGCUGUUACCUU -37.4 X & 10 emb|FP565626.1| 43462 43519
ssc-miR-421 MDM86 AUCAACAGACAUUAAUUGGGCGC CCUCAUUAAAUGUUUGUUGAAUGAAAAAAUGAAUCAUCAACAGACAUUAAUUGGGCGC -35.8     
ssc-miR-374a MDM23 UUAUAAUACAACCUGAUAAGUG UUAUAAUACAACCUGAUAAGUGUUACAGCACUUAUCAGGUUGUAUUGUAAUU -41.2     
bta-miR-2316 MDM279 CGGCCGGAGCCUGGACUGCUGC GGCGCUAGGGAGCCAGGCCGGGGAGGACAGCUGCAGCCAGCCUGUCCUCCCGUCCGGCCGGAGCCUGGACUGCUGC -63.5 15 emb|CU914511.2| 63040 62965
  MDM371 CGCGGGUGGGAAUGGGAAGG CCCCCACCCCCGCCCCGGCUGACGCAAGAACCUGGCGGGCCGCGGGUGGGAAUGGGAAGG -49.5 15 emb|CU914511.2| 63388 63431
Alternatively predicted precursors
  MDM62 UGUGUCUGUGGCCUAGGCUGGCAG UGUGUCUGUGGCCUAGGCUGGCAGGCAGCUGCAGCUCCAGUUCAACCCCUAGCCUGGGAACUUCCAUAUGCUCAGG -36.4 9 emb|CU915614.1| 87273 87348
  MDM109 UGUGUCUGUGGCCUAGGCUGGCAG GAGACAUGGUGUAGGUUGCAGACGUGGCUCAGAUCUGGCAUUGCUGUGUCUGUGGCCUAGGCUGGCAG -46.9 9 emb|CU915614.1| 87229 87296
  MDM128 GCCGGAGCUGGAGGUGGG GCCGGAGCUGGAGGUGGGCGAGGCCGCGGCACCCCCUCCGCUGCCGCCGCCGAGGGCCGCCUCCCUGGCCUCGGUGC -52.7 17 emb|FP325255.2| 141939 141863
  MDM129 GCCGGAGCUGGAGGUGGG CCUCUUCAGCGAGCGCGGCCGCUCCGUGCCCCUCGAGGAGCUGCCGGAGCUGGAGGUGGG -50.4 17 emb|FP325255.2| 141981 141922
  MDM196 AGAGGUUCGGCUGUGCGGGCA CUCCGCGGCGCUCGGAUAUCUGGCAGACCCGGGCGCGGGGAGGCUAGAGGUUCGGCUGUGCGGGCA -50.6 3 emb|FP475960.2| 151377 151312
  MDM382 AGAGGUUCGGCUGUGCGGGCA AGAGGUUCGGCUGUGCGGGCACUGCGCUCCGGGGACGGCCGCUGCACCUGC -29.2 3 emb|FP475960.2| 151332 151282
mmu-miR-2145 MDM238 AUCAGGGUCGGGCCUGG AGUGCCACCCUGAAUGCACCCGAUCUCAUCUGAUCUUGGAGGCUAAUCAGGGUCGGGCCUGG -34.8 2 emb|CU929491.4| 132342 132283
mmu-miR-2145 MDM392 AUCAGGGUCGGGCCUGG AUCAGGGUCGGGCCUGGUACUUGGUAGGGAGACAUGAGAUUUGGACCCAGAUCUGAUUA -28.8 2 emb|CU929491.4| 132299 132241
  1. The chromosomal organization of selected miRNAs that were identified by miRDeep either showing valid expression in microarray experiments or being conserved was determined by blasting against the porcine HTGS database at NCBI. Identified genomic duplications, clustering and alternatively predicted precursors are shown. Abbreviation: ND, not determined