Skip to main content

Advertisement

Table 7 Primer sequences for qRT-PCR validation

From: Transcriptome analysis of porcine PBMCs after in vitro stimulation by LPS or PMA/ionomycin using an expression array targeting the pig immune response

Gene name (Symbol) Forward Reverse Amplicon size (bp) Accession number
B2M1 TGGTCTTTCTACCTTCTGGTCC TGTGATGCCGGTTAGTGGTCTC 134 NM_004048
CD69 TCCTATCCCATGTGCTGTGGT GCACATATTGGCCTGGACAGT 104 NM_214091
CST2 TCTTGGAAGTGGAGATTGGCC CACAGCGTTTTCTTCTGCAGG 103 BG609449
IL1A GTGTGGTGATGGCAGCAGC GGTCGTCATCGGTGATGAACT 81 NM_214029
PSMB9 GCGCTTCACCACAAATGCTA TCCACACCAGCAGCTGTAATG 96 NM_001037961
PSMB8 TACCTGCTTGGCACCATGTCT AGTACAACCTGCACTCCTTGGC 82 NM_213935
LYZ TCTTGCGCTTCTCCTCCTTTC AAACATACCCAGTTCGCCAGG 129 NM_214392
PPIA GTCTCCTTCGAGCTGTTTGCA CCAAATCCTTTCTCCCCAGTG 83 NM_214353
SLAIa CATCATTGTTGGCCTGGTTC CCTTTTTCACCTGAGCGC 90 NM_001097431(SLA-1) NM_001113702(SLA-2) NM_001097427(SLA-3)
SLA-DQB AGGAGATGTCTACACCTGCCG ATTCAGACTGTGCCCGCC 80 NM_001113694
SLA-DRA ATGGGCTATCGTAGAGAATCACG CAAACATAAACTCGCCAGATTTG 80 NM_001113706
SLA-DRB1 CACAGTGGAATGGAGGGCAC AGCAGACCCAGGACGAAGC 81 NM_001113695
TAP1 CCAGTATCTCAGGGATGTTGCTG CGCTGCTTATAGCCCCACC 81 NM_001044581
TAP2 TGTTGGGTGAGACACTAATCCCTTA CAAAGGCATCAGGGTCAAAATC 81 DQ227991
TNFRSF9 TCCAGGTCACACTTCCCATGT GAACAACAGAGAAACGGAGCG 101 BE233113
  1. 1 Reference gene for qRT-PCR