Skip to main content

Table 2 SSR markers for functionally important genes in nine-spined sticklebacks and their polymorphism (P) in three populations.

From: Utility of sequenced genomes for microsatellite marker development in non-model organisms: a case study of functionally important genes in nine-spined sticklebacks (Pungitius pungitius)

Gene ID SSR marker GenBank accession no
  Locus Repeat motif Forward primer (5'-3') Reverse primer (5'-3') Ta (°C) P  
ACAPRa Ppgm1 (CTC)12 AGCTGCCATTTTAAATCCTCCTC CTCACCATGATGGAAGCCAC 53 No GU553378
ACAPRb Ppgm2 (AACT)5 GGTCTGCCAGGTCATTTCTC AACGGCACTCATCTGGTTAGT 53 Yes GU553379
AE1 Ppgm3 (GA)8GG(GA)5 AACACATGACATCACTGCAGC ACAGGTAAGTCAGTTGTTTCAGG 53 Yes GU553380
AQP9 Ppgm4 (TGT)6 AGAAAATAAGCAGCCGTAGC TGCACGTAAATGGTCTGATT 55 No GU553381
ATP1A1 Ppgm5 (TG)6 CCATAGGACGATCACAAG GAATGAAGTCTTTGTTGTGGGTC 53 No GU553382
  Ppgm6 (CA)5 AGCAGAGCAAAGAACAGGACTC GATCTCTTTTGCTCTGGAGTTGG 53 No GU553382
ATP1A2 Ppgm7 (TG)5/(GT)12 TGCATAATGGTCCCCCGTG AGGCCTTGGCATCCCTG 53 Yes GU553383
ATP4A Ppgm8 (TC)5 TCATTGTAATTTCCGCCTTT TTTCATCACCAACAGGTAGC 55 Yes GU553384
ATP6V1Aa Ppgm9 (TG)6/(TG)10 GACCGATTTCATCTCTGGAC TGACTCTTTTCCCTCCACTT 55 Yes GU553385
ATP6V1Ab Ppgm10 (CA)6 GCAGGATACCCGCTGTCT AAGTTCACAAAGGATGCACA 55 Yes GU553386
CFTR Ppgm11 (CA)13 CACTGCTAACACACATCAGC AAGCGATACCCATCTGTCC 55 Yes GU553387
CLCN3 Ppgm12 (CA)11 AGTCGGCATGGGAGTTCAC GCGATGTCAATCAGGCCG 53 Yes GU553388
CLCN4 Ppgm13 (CTC)5 GTTTGAATCCCACAACTTCA ACTACGTCAACAACCCCAAC 55 No GU553389
CLCN7 Ppgm14 (TG)10 CGCTCTGAACAGCTTAAACA ACGAGAGGGAGTGCATGA 55 Yes GU553390
CLCNK Ppgm15 (TA)4(CA)(TA) GGCCACCTAGAATTGATGAC TCAGAGTCCAAACACGAGAA 55 No GU553391
CSP2 Ppgm16 (AAAT)3 CGTCGAACTCTACAACCTCC AGACGTGTTTGTTCATCAGG 55 Yes GU553392
DIO1 Ppgm17 (TC)9 CAATCAGGATGTCCAACCA GCAGCATGGGATGAGAAC 55 Yes GU553393
eEF1A1b Ppgm18 (AC)9 CACTACAGAGTCTAGTCTGAG TCTTCAGTTAAATGAACCGGTTGC 55 Yes GU553394
FERH1 Ppgm19 (ATC)5 TTCTCTCGTTTCTCCAGAGC GAAATTGACACTGCTGGTTG 55 Yes GU553395
FGF6a Ppgm20 C12 CATCCTTCACCCCAATCTTA TCTGTCCCCTCTTTCAATGT 55 Yes GU553396
FGF18 Ppgm21 (AG)12 TGCCTACTCACACCCACTAA ATGAGAAATCAATGGAGGGA 55 Yes GU553397
GH Ppgm22 (GTATA)3 TGCGTGGTGTAGTATAGTGTAGTC AGAGCAACGTCAACTCAACA 55 No GU553398
GHRH Ppgm23 (AT)8 AAGATGAGTTTCCCGCTCTA TTATTGACTTGACCCTTGACC 55 No GU553399
GHR-1 Ppgm24 (AC)7 CCACTACCTCTGCCCTAAAA TTTCCTTTGGCTTCAATCTC 55 Yes GU553400
GHR-2 Ppgm25 (TA)6 TCAACTCTGACCTTCTTGAGG ACCACAGGTTCACCAAAGAT 55 Yes GU553401
GR1 Ppgm26 A8 CTGGTACTGTCCTGATGGAG TTCTCATAACCACAACTGGC 55 Yes GU553402
GR2 Ppgm27 A8 AGAGCACGACAAAACACAGA AGCAGAAATTGAACAGCACA 55 No GU553403
GTF2B Ppgm28 (AC)4 TGTAATCCCAATACGACGC AGTATCTGAACCCGCACATT 55 Yes GU553404
HPX Ppgm29 (AC)26 GTGCTTTTAGAAAGACCACCG TATTACTCTATAGCCGGCAGC 55 Yes GU553405
HSP25 Ppgm30 (AC)13 GCAGCGTACATTCTGTTCAAC GGTTTCTTATGTGGGTGTGAC 53 Yes GU553406
HSP47a Ppgm31 (CA)6 TGCATCATCTGCACTGAAACG GGGGCAATGATCGTCAATG 55 Yes GU553407
HSP70Aa Ppgm32 (AC)15 CAAAGACCTGCACACACATT GGGAGCTGTCGATACGTTTA 55 Yes GU553408
HSP70Ab Ppgm33 (AC)7 ATCTACAGGGATACCACAGTAC TGTTTACTCCGGTCAATGAAACC 53 No GU553409
HSP70Ac Ppgm34 (TG)5 TACTGTTCCACTTGCCCATT TCACAACTCAGGATCTCGAA 55 No GU553410
HSP70B Ppgm35 (TC)14 TGAGGGTAAAAGCTGTAGCA ATTATCCCAGAACACTCCCA 55 Yes GU553411
HSP90Ab Ppgm36 (CA)5 GTCAAACCGGACATTAGGAC CAGACGTGAAACTACGCTTG 55 Yes GU553412
HSP90B Ppgm37 (TCG)4 AGTTATGAAGAAACCGCGTC GTGATGGCTGTAGCTTGTTG 55 Yes GU553413
IGF-I Ppgm38 (CGC)4 AAGGACGAGCTCGGCTAC AGGATGCGGCTGCAGATG 53 No GU553414
IGF-II Ppgm39 (TA)13/(TA)5 GTTAGGCTTTTACTTGGGTTTCC TCATTACGCAAGATACAGCTCAG 53 Yes GU553415
Kir2.1a Ppgm40 (TA)10 CTGGAATGACACCAGCCAG AGTCAGCTCCAAGCTTGTG 53 Yes GU553416
Kir2.1c Ppgm41 (TG)7 CAAAGTGAGCAACAGTGAGC AAAGGTCGAGGAAGATGATG 55 No GU553417
Kir2.2 Ppgm42 (TC)12 ACAGGTACGAAGCGTTTAGC AGAGCAAAGAAATAGACGGG 55 Yes GU553418
MSTNa Ppgm43 (CA)5 AGTCCGCAATAAGCTCAAAC ACAAAGCCGTCTAGGTGTTC 55 No GU553419
MSTNb Ppgm44 (GGA)8 GCTGGAGCAGTACGACC GGTGATGATGGTCTCCGT 55 No GU553420
MYHa Ppgm45 (TA)3C(TA)3 AAAGCTCCAAGTAACGCTGT ACTTTTGTTTCCAATCTGCC 55 No GU553421
MYHe Ppgm46 (GTAA)4 ATGTTAATTGCTTTGTGCGA TGAAACACAGGAGCTTGAGA 55 Yes GU553422
NKCC1b Ppgm47 (CA)13 ATATGTTCAGCACGCAGCG GTCAAAGGAGTCTTAGTGAGTG 55 Yes GU553423
NPY2Rb Ppgm48 (GT)26 CACTCAGGAGAAGTGAGGC GGAACGATTACAGGTACGGAC 53 Yes GU553424
NPYP Ppgm49 T10 CTGCAGCGGACGGGATTAG AACACAGGACCGACTTTGAGG 53 No GU553425
PKMa Ppgm50 (GA)5 GTGGTACTGCTGGTTGTACT AAGGTCAAACGGCGTCGC 53 Yes GU553426
PVALBb Ppgm51 (CA)6 AGCTGAACTTTGGTGTGTCTC GTTGATGTGCATTTATGGGA 55 Yes GU553427
SHH Ppgm52 G18 AGAAACGTGGTTATTGAGGC CCTGCTCTTTATTGGGTTTT 55 Yes GU553428
SLC14 Ppgm53 (TG)13 CCATCATCTCTACACATAATCAAAC CACTGATTACAGATTGTGTGCTG 53 Yes GU553429
SSR1b Ppgm54 (TG)12 TGTCCTCGCAAAGTTCATAA TGACCGAGCATTTTACTTGA 55 Yes GU553430
T1R3 Ppgm55 T18 ATGCACTGCGTTATCACTCC GCTTTGTTTAACGTCAGTATTTCG 55 Yes GU553431
TAAR Ppgm56 (AC)12 CAAGGACCACGCTAAAGGTA GATTTCTTCTTGATGTCCGC 55 Yes GU553432
TBX4 Ppgm57 (GT)8 GAGTACGAGCAGGTTTGGTT GTAACACACACGGTTTTGGA 55 Yes GU553433
TTP Ppgm58 (AC)3(TC)(AC)3 GCCACTTATACATGCTCGC GATTCTCCCTGCCTCACA 55 Yes GU553434
  1. Ta, annealing temperature.