Table 3 Novel miRNA candidates in C. trifoliata
From: Deep sequencing discovery of novel and conserved microRNAs in trifoliate orange (Citrus trifoliata)
ID | Sequence (5'→3') | Precursor accession | A+U (%) | MFES | Location | LM | LP | No reads | RT-PCR | miRNA* |
|---|---|---|---|---|---|---|---|---|---|---|
ctr-miRn1 | AGAGAUCAAGUUGCAGAGCAA | EX447269 | 69.9 | 19.2 | 5' | 21 | 83 | 41 | + | Yes |
ctr-miRn2 | UUAAGAUUGAGUUACCAUCAU | EY823533 | 55.8 | 18 | 5' | 21 | 86 | 5 | + | Yes |
ctr-miRn3 | AUAAUGAUGUCUGUGAUGCCU | EY674266 | 55.4 | 21.7 | 3' | 21 | 81 | 14 | + | Yes |
ctr-miRn4 | UAGACCGCAAGAGACUAGCAA | EY845571 | 54.9 | 22.9 | 3' | 21 | 82 | 37 | + | Yes |
ctr-miRn5 | UGAAGGUCCGAGGUCGAGGUU | EY669005 | 66.3 | 19.8 | 3' | 21 | 83 | 10 | + | No |
ctr-mi Rn6 | UAAAUGUUGAGAGGAUUUGGC | DC890743 | 67.1 | 21 | 3' | 21 | 76 | 5 | + | No |
ctr-miRn7 | UGAGCGGCUGAAAAGAGGGAGAAA | DC893595 | 61.8 | 18.2 | 5' | 24 | 89 | 6 | + | No |
ctr-miRn8 | UAGGUGUAGAGAAGCACGAGA | CV712896 | 64.7 | 18.7 | 3' | 21 | 85 | 10 | + | No |
ctr-miRn9 | UUAGGGAUAUAACAGUUGAAU | CX297999 | 71.3 | 22.2 | 5' | 21 | 73 | 110 | + | No |
ctr-miRn10 | UUUCUUCAUGAGAGCUGGCCA | DT214737 | 47.1 | 54.5 | 5' | 21 | 87 | 268 | + | Yes |